Actinobacillus suis

From ICG
Jump to: navigation, search

Description

Actinobacillus suis-2.jpg
  • Actinobacillus suis is a Gram negative facultative anaerobe which is a frequent member of the normal microbiome of swine tonsils of the soft palate. It is also an important pathogen in pigs of all ages, where it can cause septicaemia and sequelae such as meningitis, arthritis, and pleuropneumonia [1][2].
  • Common Name: Unknown
  • NCBI Taxonomy

Different Growth Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
pyk[1] Pyruvate kinase
  • Aerobic and Epinephrine cultures
AFU19347
  • F:CAACTGAAGAAGCAATGGACGACA
  • R:AACTAACGCAGCATCACCGATTT
NA 60 SYBR
rpoB[1] DNA-directed RNA polymerase subunit β
  • Aerobic and Epinephrine cultures
AFU20083
  • F:AAACGCAACAAGATCATTCAAGGTG
  • R:ATTTGACGACGAACCGCTAAGTAAA
NA 60 SYBR
proS[1] Prolyl-tRNAsynthetase
  • Aerobic and Anoxic cultures
AFU19772
  • F:GTGGACAAAGCGTCATTACAAGAAAC
  • R:CGGAAATCTAAACCAAGACGAGTGAA
NA 60 SYBR
gyrA[1] DNA gyrase subunit A
  • Aerobic, Epinephrine, Anoxic
AFU18440
  • F:ATCTGGTATTGCGGTTGGTATGG
  • R:TTCTTCAATGCTGATTTGCTCGTTT
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Janet I MacInnes
  • Email: macinnes@uoguelph.ca
  • Institution: Department of Pathobiology, Ontario Veterinary College, University of Guelph, 50 Stone Road East, N1G 2W1 Guelph, Ontario, Canada

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Bujold AR, MacInnes JI. Validation of reference genes for quantitative real-time PCR (qPCR) analysis of Actinobacillus suis. BMC Res Notes. 2015 Mar 18;8:86. doi: 10.1186/s13104-015-1045-8. PubMed PMID: 25884823; PubMed Central PMCID: PMC4369107.
  2. Kernaghan S, Bujold AR, MacInnes JI. The microbiome of the soft palate of swine. Anim Health Res Rev. 2012;13:110–20.

Categories