Acyrthosiphon pisum

From ICG
Jump to: navigation, search

Description

Acyrthosiphon pisum.png
  • Acyrthosiphon pisum is an important cosmopolitan pest. It feeds on a wide range of legume plants worldwide, including pea, clover, alfalfa, and broad bean, and is considered as the aphid species of major agronomical importance. More importantly, it can transmit over 30 plant viruses. In addition, it is an emerging model organism for the studies of insect-plant interactions[1][2].
  • Common Name: Pea aphid
  • NCBI Taxonomy

Different Developmental Stages & Temperature

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
SDHB[1] Succinate dehydrogenase B
  • Different Developmental Stages exposed to 10 ℃, 22 ℃, and 30 ℃ for 2 days
GT035008
  • F:CTGAATTCCTGTGGACCTATGG
  • R:ACGGCAAGAACGCCTAAA
90 55 SYBR
16S[1] 16S ribosomal RNA
  • Different Developmental Stages exposed to 10 ℃, 22 ℃, and 30 ℃ for 2 days
FJ411411
  • F:AGAAACCAACCTGGCTTACAC
  • R:TTGCGACCTCGATGTTGAATTA
121 55 SYBR
NADH[1] NADH dehydrogenase
  • Different Developmental Stages exposed to 10 ℃, 22 ℃, and 30 ℃ for 2 days
NM_001162323
  • F:CGAGGAGAACATGCTCTTAGAC
  • R:GATAGCTTGGGCTGGACATATAG
93 55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xuguo Zhou
  • Email: xuguozhou@uky.edu
  • Institution: Hunan Academy of Agricultural Sciences, Institute of Plant Protection, Changsha, Hunan, China

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Yang C, Pan H, Liu Y, et al. Selection of reference genes for expression analysis using quantitative real-time PCR in the pea aphid, Acyrthosiphon pisum (Harris)(Hemiptera, Aphidiae)[J]. PloS one, 2014, 9(11): e110454.
  2. Blackman RL, Eastop VF (2000) Aphids of the World’s Crops – An Identification and Information Guide. John Wiley and Sons, Inc., New York, NY, 466 pp.

Categories