Agrostis stolonifera

From ICG
Jump to: navigation, search

Description

Agrostis stolonifera.png
  • Agrostis stolonifera is one of the most widely utilized cool-season grass species for turfgrass and forage in temperate climatic regions and displays moderate cold tolerance but is particularly sensitive to other abiotic stresses such as heat, drought, and salinity. Most studies focused on creeping bentgrass physiological mechanisms involved in heat, salt, and drought stresses, but limited information is available on the underlying molecular mechanisms conferring improved stress tolerance[1] [2].
  • Common Name: Creeping bentgrass, Creeping bent, Fiorin, Spreading bent
  • NCBI Taxonomy

Abiotic Stresses

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
CACS[1] Clathrin adaptor complex subunit
  • Salinity-treated roots or leaves of creeping bentgrass
  • Roots & leaves of creeping bentgrass under drought stress
  • Cold-treated roots & heat-stressed roots
GR280784
  • F:TAGAGGGTCTGAAGAGGCG
  • R:CTGGTGTGATCGAAAAGTGG
121 60 SYBR
UPL7[1] E3 ubiquitin-protein ligase
  • Salinity-treated roots or leaves of creeping bentgrass
  • Cold-treated leaves of creeping bentgrass
  • Heat-stressed leaves
DV858635
  • F:TGTGACTGGATGTTTTCGTGG
  • R:TTGGTTTTGTATGGGGGGA
162 60 SYBR
PP2A[1] Protein phosphatase 2A
  • Salinity-treated roots or leaves of creeping bentgrass
  • Roots or leaves of creeping bentgrass under drought stress
  • Cold-treated & heat-stressed roots
  • Cold-treated leaves of creeping bentgrass
DV858985
  • F:AACTTCCTCCAATTCGATCC
  • R:AACTTCCTCCAATTCGATCC
190 60 SYBR
ACT[1] Actin7
  • Salinity-treated roots or leaves of creeping bentgrass
DV857524
  • F:CCTTAGCACCTTCCAACAGA
  • R:AAGTGGAAAGACCCAAGACAA
114 60 SYBR
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Roots or leaves of creeping bentgrass under drought stress
  • Heat-stressed leaves
GR281777
  • F:GCCTTCCGTGTTCCTACTGT
  • R:AAGATGCTGGACCTGCTGTC
191 60 SYBR
PEPKR1[1] Phosphoenolpyruvate carboxylase- related Kinase 1
  • Roots or leaves of creeping bentgrass under drought stress.
DV853577
  • F:ACCGATGTTGTTGGAAGCC
  • R:ACACCACTCAGCAGAATGTAGAG
116 60 SYBR
EF1a[1] Elongation factor-1a
  • Cold-treated leaves of creeping bentgrass
DV858943
  • F:CAAGGTTACCAAGGCTGCTG
  • R:GGTTTTGCCGAACATGAAATAG
170 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhimin Yang
  • Email: nauyzm@njau.edu.cn
  • Institution: College of Agro-grassland Science, Nanjing Agricultural University, Nanjing 210095, China

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Chen Y, Hu B, Tan Z, et al. (2015) Selection of reference genes for quantitative real-time PCR normalization in creeping bentgrass involved in four abiotic stresses. Plant Cell Rep 34, 1825-1834.
  2. Steer J, Harris JA (2000) Shifts in the microbial community in rhizosphere and non-rhizosphere soils during the growth of Agrostis stolonifera. Soil Biology & Biochemistry 32, 869-878.

Categories