Ammopiptanthus mongolicus

From ICG
Jump to: navigation, search

Description

Ammopiptanthus mongolicus.png
  • Ammopiptanthus mongolicus, the only evergreen broadleaf shrub endemic to the northwest desert of China, is the only genus of evergreen broadleaf shrub in the northwest desert of China and is dominant in the local vegetation. It plays important roles in fixing moving sands and delaying further desertification. It is a valuable species for plant abiotic stress research and has been proposed as a valuable species for research on plant abiotic stress tolerance[1][2].
  • Common Name: Leguminosae
  • NCBI Taxonomy

Abiotic Stresses

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
eIF1[1] Eukaryotic initiation factor
  • Cold stresses
  • Dry stresses
  • Salt stresses
  • Heat stresses
JN885965
  • F:CTGACATGCGCCGTAGGAACG
  • R:CCCTGCTTATGCCAGTCTTTT
153 60 SYBR
eIF3[1] Eukaryotic initiation factor
  • Cold stresses
  • Dry stresses
  • Salt stresses
  • Heat stresses
JN885967
  • F:TTACATCGTCATCAAGGGTCG
  • R:ACAATTATGGGAAGACGGCAC
153 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jing Shi
  • Email: yinwl@bjfu.edu.cn
  • Institution: National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, College of Biological Sciences and Biotechnology, Beijing Forestry University Beijing 100083, China

Citation Statistics

Cited by 19 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Shi J, Liu M, Shi J, et al. Reference gene selection for qPCR in Ammopiptanthus mongolicus under abiotic stresses and expression analysis of seven ROS-scavenging enzyme genes[J]. Plant cell reports, 2012, 31(7): 1245-1254.
  2. Libauh M, Thibivilliers S, Bilgin DD, Radwan O, Benitez M, Clough SJ, Stacey G (2008) Identification of four soybean reference genes for gene expression normalization. Plant Genome 1:44–54.

Categories