Anastrepha obliqua

From ICG
Jump to: navigation, search

Description

Anastrepha obliqua.png
  • Anastrepha obliqua, a kind of tephritid fruit flies, which is also an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control. The genus Anastrepha has over 235 species, most of them are endemic to the Neotropics. Only a few of these species, mostly in the fraterculus group, are agricultural pests, including Anastrepha obliqua. Because of the vast damage they inflict to several different fruit crops, they are of great economic importance, which elicit the development of several pest management strategies[1] [2].
  • Common Name: West Indian fruit fly
  • NCBI Taxonomy

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
rpL18[1] Ribosomal protein L18
  • 2nd and 3rd larval instars (LII and LIII);
  • Early pupal stage (PI);
  • Later pupal stage (PII);
  • Sexually mature virgin males and females (MVF);
  • Post-mating males (PMM) and females (PMF);
NM_139834
  • F:GTGCCTAAGATGACCATTTGC
  • R:GACCTCCAGCCTTAATGATACG
NA 58 SsoFast
rps17[1] Ribosomal protein S17
  • 2nd and 3rd larval instars (LII and LIII);
  • Early pupal stage (PI);
  • Later pupal stage (PII);
  • Sexually mature virgin males and females (MVF);
  • Post-mating males (PMM) and females (PMF);
NM_079278.2
  • F:GCCGCAAAGGTCATAATTGAG
  • R:GCTACTTCTTCACAAATACGCT
NA 58 SsoFast
ef1a[1] Elongation factor-1 alpha
  • 2nd and 3rd larval instars (LII and LIII);
  • Early pupal stage (PI);
  • Later pupal stage (PII);
  • Sexually mature virgin males and females (MVF);
  • Post-mating males (PMM) and females (PMF);
GU339154.1
  • F:TTGCCTTCGTACCAATCTCTG
  • R:AACCTTCCATCCCTTGAACC
NA 59 SsoFast

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Reinaldo Alves de Brito
  • Email: brito@ufscar.br
  • Institution:Departamento de Genética e Evolução, Universidade Federal de São Carlos, São Carlos, Brazil.

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Nakamura AM, Chahad-Ehlers S, Lima AL, et al. (2016) Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua. Sci Rep 6, 17480.
  2. Figueiredo JV, Perondini AL, Selivon D (2017) Patterns of inner chorion structure in Anastrepha (Diptera: Tephritidae) eggs. Arthropod Struct Dev 46, 236-245.

Categories