Anthurium andraeanum

From ICG
Jump to: navigation, search

Description

Anthurium andraeanum.png
  • Anthurium andraeanum (Hort.) is an ornamental crop cultivated for its cut-flower, which is commercially second only to orchids among tropical flowers. The cut-flower consists of a protruding inflorescence called the spadix that is subtended by a modified leaf called the spathe. The spathe is usually brilliantly colored and heart-shaped and is the more attractive part of the cut-flower[1][2][3][4].
  • Common Name: Tailflower, Flamingo flower, Laceleaf
  • NCBI Taxonomy

Spathe Tissue

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
CYP[1] Cyclophilin
  • Spathe tissues
  • Different cultivars, color groups, developmental stages and harvesting times
JN602201
  • F:GGCAAGCCCCTCCACTACAA
  • R:GCCCTGGCACATGAACTGGG
65 60 SYBR
UBQ5[1] Ubiquitin-like protein 5
  • Spathe tissues
  • Different cultivars, color groups, developmental stages and harvesting times
JN602199
  • F:TCCGCATCCAGAAGTGGTAC
  • R:TGCCGTCGTGGATCTCGTAG
72 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pathmanathan Umaharan
  • Email: pumaharan@sta.uwi.edu
  • Institution: Department of Life Sciences, Faculty of Science and Technology, The University of the West Indies, St. Augustine Campus, College Road, Republic of Trinidad and Tobago

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Gopaulchan D, Lennon A M, Umaharan P. Identification of reference genes for expression studies using quantitative RT-PCR in spathe tissue of Anthurium andraeanum (Hort.)[J]. Scientia Horticulturae, 2013, 153: 1-7.
  2. Gopaulchan D, Umaharan P, Lennon AM (2014) A molecular assessment of the genetic model of spathe color inheritance in Anthurium andraeanum (Hort.). Planta 239:695–705. doi:10. 1007/s00425-013-2007-9
  3. Li C, Yang G, Huang S, Lu¨ D, Wang C, Chen J, Yin J (2013a) Characterisation of flavonoids in anthurium spathes and their contribution to spathe colouration. J Hortic Sci Biotech 88:208–215
  4. Iwata RY, Tang CS, Kamemoto H (1985) Concentration of anthocyanins affecting spathe color in anthuriums. J Am Soc Hortic Sci 110:383–385

Categories