Aphis gossypii

From ICG
Jump to: navigation, search

Description

Aphis gossypii.png
  • Aphis gossypii, the cotton aphid, is a tiny greenfly that sucks sap from plants. It belongs to the superfamily Aphidoidea in the order Hemiptera. It is a widely distributed pest of a variety of agriculturally important crops in the families Cucurbitaceae, Rutaceae and Malvaceae, causing damage through feeding and virus transmission. The cotton aphid control is primarily dependent on the application of insecticides, often with multiple applications each year in China [1] [2].
  • Common Name: Greenfly, Cotton aphid, Melon aphid
  • NCBI Taxonomy

Different Developmental Stages & Geographical Populations

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1α[1] Elongation factor 1 alpha
  • Divergent developmental stages
  • Different geographical populations
EU019874.1
  • F:GAAGCCTGGTATGGTTGTCGT
  • R:GGGTGGGTTGTTCTTTGTG
187 60 SYBR
β-ACT[1] beta-actin
  • Divergent developmental stages
  • Different geographical populations
KF018928.1
  • F:TCTTGGGAATGGAATCTTGC
  • R:GGACAGAGAAGCCAAGATGG
254 60 SYBR
RPL7[1] Ribosomal protein L7
  • Divergent developmental stages
  • Experiments of the temperature changes
KP676382
  • F:TGCCGGAGTCTGTACTCAA
  • R:TCACACCACGAATACGCA
255 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Experiments of the temperature changes
KP676380
  • F:ACTACTGTTCATGCAACCACCG
  • R:GCTGCTTCCTTAACCTTATCCT
272 60 SYBR
18S[1] 18S ribosomal
  • Feeding assay experiments
KF018922.1
  • F:ATTGACGGAAGGGCACC
  • R:CGCTCCACCAACTAAGAACG
157 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xi-Wu Gao
  • Email: gaoxiwu@263.net.cn
  • Institution: Department of Entomology, China Agricultural University, Beijing 100193, People’s Republic of China

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Ma KS, Li F, Liang PZ, et al. (2016) Identification and Validation of Reference Genes for the Normalization of Gene Expression Data in qRT-PCR Analysis in Aphis gossypii (Hemiptera: Aphididae). J Insect Sci 16.
  2. Cao CW, Zhang J, Gao XW, Liang P, Guo HL (2008) Overexpression of carboxylesterase gene associated with organophosphorous insecticide resistance in cotton aphids, Aphis gossypii (Glover). Pesticide Biochemistry and Physiology 90, 175-180.

Categories