Arabidopsis thaliana

From ICG
Jump to: navigation, search

Description

Arabidopsis thaliana.png
  • Arabidopsis thaliana is the model plant for both traditional and modern genetic studies for over 70 years. As a member of the mustard family, it is well suited for genetic studies because of the short generation time of only 5 weeks, numerous seeds per plant and the small plant size. Arabidopsis requires only moist soil and fluorescent light for rapid growth. Self-fertilization allows new mutations to be made homozygous with minimal effort. Cross-fertilization can also be simply and rapidly effected when desired, which make the genetic mapping and the production of multiple mutant stocks possible[1].
  • Common Name: Rockcress,Mousear Cress,Arabidopsis
  • NCBI Taxonomy

Iron Deficiency

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
SAND[2] SAND family protein
  • Iron deficiency
AK118037
  • F:AACTCTATGCAGCATTTGATCCACT
  • R:TGATTGCATATCTTTATCGCCATC
NA 60 SYBR
YLS8[2] Mitosis protein YLS8
  • Iron deficiency
AF324685
  • F:TTACTGTTTCGGTTGTTCTCCATTT
  • R:CACTGAATCATGTTCGAAGCAAGT
NA 60 SYBR
TIP41-like[2] TIP41-like family protein
  • Iron deficiency
AY091389
  • F:GTGAAAACTGTTGGAGAGAAGCAA
  • R:TCAACTGGATACCCTTTCGCA
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Bin Han
  • Email: wbshenh@njau.edu.cn
  • Institution: College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China

Citation Statistics

Cited by 18 (Based on Google Scholar [2017-09-01])

References

  1. Meyerowitz E M, Pruitt R E. Arabidopsis thaliana and plant molecular genetics[J]. Science, 1985, 229(4719): 1214-1218.
  2. 2.0 2.1 2.2 Han B, Yang Z, Samma M K, et al. Systematic validation of candidate reference genes for qRT-PCR normalization under iron deficiency in Arabidopsis[J]. Biometals, 2013, 26(3): 403-413.

Categories