Arachis hypogaea

From ICG
Jump to: navigation, search

Description

Arachis hypogaea.png
  • Arachis hypogaea L., an allotetraploid species, is one of the Wve most important oilseed crops cultivated worldwide. It is an important food and oil crop, is grown throughout the tropics and subtropics. Cultivated peanut is an allotetraploid (AABB genome). Its ancestral species are most likely the diploid Arachis duranensis and Arachis ipaensis, which contributed the A and B subgenomes, respectively Peanut seed contains 50% oil, of which 80% consists of oleic acids and linoleic acids[1][2].
  • Common Name: Peanut
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ADH3[1] Alcohol dehydrogenase
  • Virus challenging experiments
  • Salinity and drought
EG529529
  • F:GCTTCAAGAGCAGGTCACAAGT
  • R:GAGACATCCTCCTTCGTGCATA
143 60 SYBR
G6PD[1] Glucose-6-phospahate 1- dehydrogenase
  • Virus challenging experiments
  • Salinity and drought
EG030635
  • F:ACCATTCCAGAGGCTTATGAGC
  • R:AAGGGAGTGACTTGAACTCTCC
151 60 SYBR
ELF1B[1] Elongation factor 1B
  • Virus challenging experiments
  • Salinity and drought
EE126175
  • F:AAGCTTCCCTGGCAAAGCTCAA
  • R:TTCCTCAGCTGCCTTCTTATCC
153 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pooja Bhatnagar-Mathur
  • Email: p.bhatnagar@cgiar.org
  • Institution: International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, Andhra Pradesh, India

Citation Statistics

Cited by 33 (Based on Google Scholar [2017-09-01])

Different Developmental Stages & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UKN1[2] Hypothetical protein
  • Various tissue types
  • Seed developmental stages
  • Salt-treated roots
EG028875
  • F:AACGAAGACGACGACGAAGAAC
  • R:GAACAATAGCAACAAGAAGCAAAGC
102 58~60 SYBR
TUA5[2] Alpha tubulin
  • Various tissue types
  • Seed developmental stages
  • Under cold treatment
  • Salt-treated leaves
GO264294
  • F:CTGATGTCGCTGTGCTCTTGG
  • R:CTGTTGAGGTTGGTGTAGGTAGG
94 58~60 SYBR
UKN2[2] Hypothetical protein
  • Various tissue types
  • Salt-treated leaves
GO334386
  • F:GGAAGATGGCGAGAAGCAACAG
  • R:GCGAAGAGCGTAGAGTAGAAGTG
89 58~60 SYBR
ACT11[2] Actin 11
  • Various tissue types
GO264911
  • F:TTGGAATGGGTCAGAAGGATGC
  • R:GCTTCTTACTGAGGCACCACT
196 58~60 SYBR
EF1b[2] Elongation factor 1b
  • Under cold treatment
GO339841
  • F:GCTGCTGCTGCTGATGACG
  • R:TGCCTTCTTATCCTCCTCTGTCTC
66 58~60 SYBR
HDC[2] Nuclear helicase
  • Salt-treated roots
EE123564
  • F:GCCACCAGAGCCGCTATCG
  • R:GCCACCAGAGCCGCTATCG
196 58~60 SYBR

Molecular types

  • mRNA

Evaluation Methods

Contact

  • Name: Shanlin Yu
  • Email: yshanlin1956@163.com
  • Institution: Shandong Peanut Research Institute, Qingdao 266100, People’s Republic of China

Citation Statistics

Cited by 60 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Reddy D S, Bhatnagar-Mathur P, Cindhuri K S, et al. Evaluation and validation of reference genes for normalization of quantitative real-time PCR based gene expression studies in peanut[J]. PloS one, 2013, 8(10): e78555.
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 Chi X, Hu R, Yang Q, et al. Validation of reference genes for gene expression studies in peanut by quantitative real-time RT-PCR[J]. Molecular Genetics and Genomics, 2012, 287(2): 167-176.

Categories