Aspergillus niger

From ICG
Jump to: navigation, search

Description

Aspergillus niger.png
  • Aspergillus niger is a member of the genus Aspergillus which includes a set of fungi that are generally considered asexual, although perfect forms (forms that reproduce sexually) have been found. Aspergilli are ubiquitous in nature. Aspergillus niger grows poorly on acetamide as a nitrogen or carbon source and lacks sequences detectably homologous to the amdS gene encoding the acetamidase of Aspergillus nidulans[1][2].
  • Common Name: Aspergillus
  • NCBI Taxonomy

Continuous Cultivation

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
act[1] Actin
  • Universal reference genes
AJ132229
  • F:GGTCTGGAGAGCGGTGGTAT
  • R:CACTGCGAAGAAGGAGCAAGAGCAGTG
NA 60 NA
cox5[1] Cytochrome c oxidase subunit V
  • Universal reference genes
AJ132229
  • F:GACCAAGGAGTGGCAGGAG
  • R: GAACTGGGTGGGAGGCAGCAGTTC
NA 60 NA

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: K. Bohle
  • Email: ibvt@tu-bs.de
  • Institution: Technische Universität Braunschweig, Institute of Biochemical Engineering, Gaußstraße 17, D-38106 Braunschweig, Germany

Citation Statistics

Cited by 35 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Bohle K, Jungebloud A, Göcke Y, et al. Selection of reference genes for normalisation of specific gene quantification data of Aspergillus niger[J]. Journal of biotechnology, 2007, 132(4): 353-358.
  2. Kelly JM, Hynes MJ. Transformation of Aspergillus niger by the amdS gene of Aspergillus nidulans. The EMBO Journal. 1985;4(2):475-479.

Categories