Hippoglossus hippoglossus

Description

Hippoglossus hippoglossus is a flatfish of the family Pleuronectidae. It is demersal fish living on or near sand, gravel or clay bottoms at depths of between 50 and 2,000m. It is among the largest teleost (bony) fish in the world, and is an endangered species due to a slow rate of growth and previous overfishing. In addition, as it reaches considerably big size at sexual maturity the handling is labor-intensive and broodstock maintenance is costly^[1]^[2].
Common Name: Atlantic halibut
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
EF1A1^[1]	Elongation factor 1 alpha	Before activation of zygotic transcription； after hatching； various halibut organs，both in non-injected fish and in mock- and NNV-injected fish	EU561358	F:CCATGGTTGTGGAGTCCTTCTC R:GATGACACCGACAGCCACTGT	NA	60	TaqMan
UbcE^[1]	Ubiquitin-conjugating enzyme E2L 3	Before activation of zygotic transcription	FJ008912	F:GAACTGGAAACCAGCGACAAA R:CGCTCACCAGAGCAATGAGA	NA	60	TaqMan
RPL7^[1]	Ribosomal protein L7	After hatching； various halibut organs, both in non-injected fish and in mock- and NNV-injected fish	FJ008911	F:GAAGGCTCTCGGCAAATATGG R:GCCAACTGTGTAAATCTCATGGAT	NA	60	TaqMan

Name: Sonal Patel
Email: aina-cathrine.oevergaard@imr.no
Institution: Institute of Marine Research, PO Box 1870 Nordnes, N-5817 Bergen, Norway

Cited by 51 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Øvergård A C, Nerland A H, Patel S. Evaluation of potential reference genes for real time RT-PCR studies in Atlantic halibut (Hippoglossus Hippoglossus L.); during development, in tissues of healthy and NNV-injected fish, and in anterior kidney leucocytes[J]. BMC molecular biology, 2010, 11(1): 36.
↑ Skaalsvik TH, Bolla SL, Thornqvist PO, Babiak I.Theriogenology. 2015 Jan 1;83(1):38-47.PMID: 25459032.