Atropa belladonna

From ICG
Jump to: navigation, search

Description

Atropa belladonna.png
  • Atropa belladonna, commonly known as belladonna or deadly nightshade, is a perennial herbaceous plant in the nightshade family Solanaceae, which includes tomatoes, potatoes, eggplant, etc. It is native to Europe, North Africa, and Western Asia. Its distribution extends from Great Britain in the west to western Ukraine and the Iranian province of Gilan in the east. It is also naturalised and/or introduced in some parts of Canada and the United States, with a history of medical applications due to its alkaloids, atropine and scopolamine[1][2].
  • Common Name: Belladonna, Deadly nightshade
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PGK[1] Phosphoglycerate kinase
  • Root, stem, and leaf
  • Cold, heat, NaCl, UV-B
  • Methyl jasmonate, salicylic acid, and abscisic acid treatments
JX154676
  • F:TCGCTCTTGGAGAAGGTTGAC
  • R:CTTGTCGGCAATCACTACATCAG
195 59.5 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhihua Liao
  • Email: zhliao@swu.edu.cn
  • Institution: Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), Chongqing Engineering and Technology Research Center for Sweetpotato, School of Life Sciences, Southwest University, Chongqing 400715, China

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 Li J, Chen M, Qiu F, et al. (2014) Reference Gene Selection for Gene Expression Studies Using Quantitative Real-Time PCR Normalization in Atropa belladonna. Plant Molecular Biology Reporter 32, 1002-1014.
  2. Volkov RA, Panchuk II, Borisjuk NV, et al. (2017) Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna. Bmc Plant Biology 17.

Categories