Lucilia cuprina

Description

Lucilia cuprina，is an important pest of sheep in Australia and other parts of the world. It is a member of the order Diptera, has a pair of short but very strong membranous wings and a pair of hindwings reduced and modified to clublike balancers known as halteres. It is of significant concern as a result of the welfare issues and production losses that arise when gravid female blow flies deposit eggs on sheep, giving rise to fly strike. It is an important ecto-parasite that causes fly strike, which has significant health and welfare, as well as economic, impacts on the sheep industry in Australia^[1] ^[2].
Common Name: Australian sheep blowfly
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
18S rRNA^[1]	18S rRNA	Eggs, L1, L3, pupae and adult life stages	AF322425	F:AGCAGTTTGGGGGCATTAG R:AGCAGTTTGGGGGCATTAG	NA	NA	SYBR
28S rRNA^[1]	28S rRNA	Eggs, L1, L3, pupae and adult life stages	EU626548	F:CCAAAGAGTCGTGTTGCTTG R:ATTCAGGTTCATCGGGCTTA	NA	NA	SYBR
GST1^[1]	Glutathione S-transferase	Eggs, L1, L3, pupae and adult life stages	L23126	F:GCCAGTGTCAGCACCTTTG R:GCAACCTTCCCAGTTTTCATC	NA	NA	SYBR
β-tubulin^[1]	β-tubulin	Eggs, L1, L3, pupae and adult life stages	GQ284558	F:AAGCTGACGACACCCACATAC R:CGGGCATGAAGAAGTGAAGA	NA	NA	SYBR
RPLPO^[1]	Acidic ribosomal phosphoprotein PO	Eggs, L1, L3, pupae and adult life stages	GQ284556	F:ACCCATAAGGACGACACC R:GGTGCTGACAATGTTGGTTC	NA	NA	SYBR

Name: A.C.KOTZE
Email: andrew.kotze@csiro.au
Institution: CSIRO (Commonwealth Scientific & Industrial Research Organization) Livestock Industries, St. Lucia, Brisbane, Queensland, Australia

Cited by 28 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 Bagnall N H, Kotze A C. Evaluation of reference genes for real‐time PCR quantification of gene expression in the Australian sheep blowfly, Lucilia cuprina[J]. Medical and veterinary entomology, 2010, 24(2): 176-181.
↑ Bagnall NH, Hines BM, Lucke AJ, Gupta PK, Reid RC, Fairlie DP, Kotze AC.Int J Parasitol Drugs Drug Resist. 2017 Apr;7(1):51-60. doi: 10.1016/j.ijpddr.2017.01.001. Epub 2017 Jan 10.PMID: 28110187 Free PMC Article.