Balanus amphitrite

From ICG
Jump to: navigation, search

Description

Balanus amphitrite.png
  • Balanus amphitrite is a sessile gregarious species that is a model organism for both fundamental and applied larval settlement studies due to its invasive behaviour, its worldwide distribution, and the relative simplicity of manipulating its reproduction in the laboratory. Its life cycle is characterized by the presence of six planktonic naupliar stages (naupliar instar I-VI) followed by a non-feeding larval stage, the cyprid, that is specialized to explore the substratum in order to locate a suitable place for permanent attachment. A number of behavioural studies have shown that B. amphitrite cyprids respond to biotic and abiotic factors as they explore the substratum. To date, however, the paucity of genomic information available for this organism has hindered in-depth mechanistic studies of the surface colonization process[1].
  • Common Name: Barnacle
  • NCBI Taxonomy

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
mt-cyb[1] Cytochrome b
  • Developmental stages
FM882286
  • F:GGACACTGCATGCTAATGGA
  • R:AGGCAGCAGCCATAGTCAAG
144 60 SYBR
mt-nd1[1] NADH dehydrogenase subunit 1
  • Developmental stages
FM882393
  • F:CGGGCTGTTGCTCAAACTA
  • R:TTCGACAAAATCTTCCAATCT
102 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Tristano Bacchetti De Gregoris
  • Email: t.bacchetti-de-gregoris@ncl.ac.uk
  • Institution: School of Marine Science and Technology, Ridley Building, Newcastle University, Newcastle upon Tyne, NE1 7RU, England, UK

Citation Statistics

Cited by 32 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 De Gregoris T B, Borra M, Biffali E, et al. Construction of an adult barnacle (Balanus amphitrite) cDNA library and selection of reference genes for quantitative RT-PCR studies[J]. BMC molecular biology, 2009, 10(1): 62.

Categories