Bemisia tabaci

From ICG
Jump to: navigation, search

Description

Bemisia tabaci.png
  • Bemisia tabaci has long been considered a complex species of 11 well-defined high-level groups containing at least 24 morphologically indistinguishable species. It is a considerable pest of ornamental, vegetable, grain legume, and cotton production, causing damage directly through feeding and indirectly through the transmission of plant pathogenic viruses, primarily begomoviruses. It rose to global prominence in the 1980s owing to the global invasion by the commonly named B biotype. Since then, the concomitant eruption of a group of plant viruses known as begomoviruses has created considerable management problems in many countries[1][2].
  • Common Name: Sweetpotato whitefly, Silverleaf whitefly
  • NCBI Taxonomy

Different Commercially Available Insecticides

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1a[1] Elongation factor1-alpha
  • Different insecticide treatments
EE600682
  • F:GATGGCACGGAGACAATATG
  • R:TTGTCAGTGGGTCTGCTAGG
138 60 SYBR
TUB1a[1] Tubulin alpha-1 chain
  • Different insecticide treatments
EE598061
  • F:CACTGTTGTTCCTGGTGGC
  • R:AGTGGACGAAAGCACGCTTG
140 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Different insecticide treatments
JU470454
  • F:AAATGACTTTCCCTACAGC
  • R:ATTATGGCGTGATGGC
82 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiwu Gao
  • Email: gaoxiwu@263.net.cn
  • Institution: Department of Entomology, China Agricultural University, Beijing, P. R. China

Citation Statistics

Cited by 19 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Liang P, Guo Y, Zhou X, Gao X (2014) Expression profiling in Bemisia tabaci under insecticide treatment: indicating the necessity for custom reference gene selection. PLoS One 9, e87514
  2. De Barro PJ, Liu SS, Boykin LM, Dinsdale AB (2011) Bemisia tabaci: A Statement of Species Status. Annual Review of Entomology, Vol 56 56, 1-19.

Categories