Schistosoma japonicum

Description

Schistosoma japonicum is an important parasitic that cause Schistosomiasis that ranks with malaria and tuberculosis in term of morbidity and mortality. It infects more than 200 million people in 76 tropical and subtropical countries. More than 40 mammalian animals are reservoir hosts that play a role in maintaining the parasite and increasing the chances for human infection. In China, there are several hundred thousand livestock, including over 200,000 buffalo currently infected^[1]^[2].
Common Name: Blood fluke
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
PSMD4^[1]	26S proteasome non-ATPase regulatory subunit 4	Different developmental stages (cercariae, hepatic schistosomula, separated adult male and female worms, and eggs)	FN320595	F:CCTCACCAACAATTTCCACATCT R:GATCACTTATAGCCTTGCGAACAT	129	60	SYBR
NDUFV2^[1]	NADH dehydrogenase (ubiquinone) flavoprotein 2	Different developmental stages (cercariae, hepatic schistosomula, separated adult male and female worms, and eggs)	FN320220	F:CGAGGACCTAACAGCAGAGG R:TCCGAACGAACTTTGAATCC	174	60	SYBR
TPC2L^[1]	Trafficking protein particle complex subunit 2-like protein	Different developmental stages (cercariae, hepatic schistosomula, separated adult male and female worms, and eggs)	AY815746	F:TGGAACATTCTGATTGTGCCT R:CGATGCCGTAATAGAACTAACA	140	60	SYBR

Name: Qijun Chen
Email: qijun.chen@ipbcams.ac.cn
Institution: Institute of Pathogen Biology, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, China

Cited by 41 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Liu S, Cai P, Hou N, et al. Genome-wide identification and characterization of a panel of house-keeping genes in Schistosoma japonicum[J]. Molecular and biochemical parasitology, 2012, 182(1): 75-82.
↑ Shuai Liu, Pengfei Cai, Nan Hou, Xianyu Piao, Heng Wang, Tao Hung, Qijun Chen. Genome-wide identification and characterization of a panel of house-keeping genes in Schistosoma japonicum. 0166-6851/$ – see front matter 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.molbiopara.2011.12.007 PMID: 22245333.