Bombyx mori

From ICG
Jump to: navigation, search

Description

Bombyx mori.png
  • Bombyx mori is a domesticated insect that has been intimately associated with humans for over 5000 years. It has been and continues to be employed to produce silk, and has contributed greatly to the economic development of countries along the ancient Silk Road and cultural exchanges between the East and West. Since the nineteenth century, B. mori has begun to serve as a reference or model organism for studies in the life sciences and has contributed many classic paradigms associated with our understanding of genetics and molecular biology[1][2].
  • Common Name: Silkworm
  • NCBI Taxonomy

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF4A[1] Translation initiation factor 4A
  • During metamorphism
DQ443290
  • F:TTCGTACTGGCTCTTCTCGT
  • R:CAAAGTTGATAGCAATTCCCT
174 55 SYBR
EF3A4[1] Translation initiation factor 3 subunit 4
  • During metamorphism
DQ443289
  • F:ACTTCAAGTTCAGGGCAGAT
  • R:TTAATTGTTTTGTGGAGGCT
110 55 SYBR
EF3A5[1] Translation initiation factor 3 subunit 5
  • During metamorphism
NM_001047063
  • F:ATTGCAGCTCGCACATTC
  • R:AGTTGGAGTTGGGTCTTGAT
126 55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Qing-You Xia
  • Email: xiaqy@swu.edu.cn
  • Institution: Institute of Agriculture and Life Sciences, Chongqing University and the Key Sericultural Laboratory of Agricultural Ministry, School of Biotechnology, Southwest University, Chongqing, China

Citation Statistics

Cited by 38 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Gen-Hong, Wang, Qing-You, et al. Reference genes identified in the silkworm Bombyx moil during metamorphism based on oligonucleotide microarray and confirmed by qRT-PCR[J].2008(5):405-413.
  2. Xu H, O'Brochta DA. Advanced technologies for genetically manipulating the silkworm Bombyx mori, a model Lepidopteran insect. Proc Biol Sci. 2015 Jul 7;282(1810). pii: 20150487. doi: 10.1098/rspb.2015.0487. Review. PubMed PMID: 26108630; PubMed Central PMCID: PMC4590473.

Categories