Bos indicus

From ICG
Jump to: navigation, search

Description

Bos indicus.png
  • Bos indicus are the most common type of large domesticated ungulates. They are a prominent modern member of the subfamily Bovinae, are the most widespread species of the genus Bos. They are characterised by a fatty hump on their shoulders, a large dewlap, and sometimes drooping ears. They are well adapted to withstanding high temperatures, and are farmed throughout the tropical countries. They are raised as livestock for meat (beef and veal), as dairy animals for milk and other dairy products. Other products include leather and dung for manure or fuel[1][2].
  • Common Name: Zebu, Zebu cattle
  • NCBI Taxonomy

Milk Somatic Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PPP1R11[1] Protein phosphatase 1 regulatory subunit 11
  • Milk somatic cells
  • Multiparous lactating Sahiwal cows
  • Different lactation stages
NM_001100295
  • F:ACCATCAAACTTCGGAAACG
  • R:CCTCCTCTTCCTCGTCATCA
NA 60 SYBR
ACTB[1] β-actin
  • Milk somatic cells
  • Multiparous lactating Sahiwal cows
  • Different lactation stages
NM_173979
  • F:CTCTTCCAGCCTTCCTTCCT
  • R:GGGCAGTGATCTCTTTCTGC
NA 63 SYBR
UBC[1] Ubiquitin
  • Milk somatic cells
  • Multiparous lactating Sahiwal cows
  • Different lactation stages
Z18245
  • F:AGATCCAGGATAAGGAAGGCAT
  • R:GCTCCACCTCCAGGGTGAT
NA 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Milk somatic cells
  • Multiparous lactating Sahiwal cows
  • Different lactation stages
NM_001034034.1
  • F:GGGTCATCATCTCTGCACCT
  • R:GGTCATAAGTCCCTCCACGA
NA 62 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Mohanty
  • Email: ashokmohanty1@gmail.com
  • Institution: ational Dairy Research Institute, Karnal 132001, India

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Varshney N, Mohanty A K, Kumar S, et al. Selection of suitable reference genes for quantitative gene expression studies in milk somatic cells of lactating cows (Bos indicus)[J]. Journal of dairy science, 2012, 95(6): 2935-2945.
  2. N. Varshney, A. K. Mohanty , S. Kumar , J. K. Kaushik, A. K. Dang ,M. Mukesh , B. P. Mishra , R. Kataria , S. P. Kimothi ,T. K. Mukhopadhyay , D. Malakar , B. S. Prakash , S. Grover , and V. K. Batish. Selection of suitable reference genes for quantitative gene expression studies in milk somatic cells of lactating cows (Bos indicus). J. Dairy Sci. 95 :2935–2945 http://dx.doi.org/ 10.3168/jds.2011-4442.

Categories