Bos taurus

From ICG
Jump to: navigation, search

Description

Bos taurus.png
  • Bos taurus are the most common type of large ungulates which were domesticated from 80 progenitors in southeast Turkey around 10,500 years ago. They are prominent modern member of the subfamily Bovinae, are the most widespread species of the genus Bos. Cattle are raised as livestock for meat (beef and veal), as dairy animals for milk and other dairy products, and as draft animals. Other products include leather and dung for manure or fuel. In some regions, such as parts of India, cattle have significant religious meaning[1][2].
  • Common Name: Cattle
  • NCBI Taxonomy

Viral Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UCHL5[1] Ubiquitin carboxyl-terminal hydrolase L5
  • Leukemia-virus infected
NM_174481
  • F:ACAAAGACAACTTGCTGAGGAACCC
  • R:GGCAACCTCTGACTGAATAGCACTT
79 60 SYBR
RPLP0[1] Ribosomal protein large P0
  • Leukemia-virus infected
NM_001012682
  • F:CAACCCTGAAGTGCTTGACAT
  • R:AGGCAGATGGATCAGCCA
227 58 SYBR
TBP[1] TATA box binding protein
  • Leukemia-virus infected
NM_001075742
  • F:ACAGCCTCCCACCCTATGCCC
  • R:GCTGTGGAGTCAGTCCTGTGCC
111 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: P. Brym
  • Email: pawbrym@uwm.edu.pl
  • Institution: Department of Animal Genetics, University of Warmia and Mazury in Olsztyn, Oczapowskiego 5, 10-719 Olsztyn, Poland

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Brym P, Ruść A, Kamiński S. Evaluation of reference genes for qRT-PCR gene expression studies in whole blood samples from healthy and leukemia-virus infected cattle[J]. Veterinary immunology and immunopathology, 2013, 153(3): 302-307.
  2. Lene Munksgaard, Margit B. Jensen, Lene J. Pedersen, Steffen W. Hansen, Lindsay Matthews, Quantifying behavioural priorities—effects of time constraints on behaviour of dairy cows, , Applied Animal Behaviour Science, Volume 92, Issue 1, 2005, Pages 3-14, ISSN 0168-1591.

Categories