Bostrychia moritziana

From ICG
Jump to: navigation, search

Description

Bostrychia moritziana-1.jpg
  • Bostrychia moritziana is a red alga and a member of the Florideophyceae. The class Florideophyceae contains approximately 90% of all described red algal species. Bostrychia has been proposed as a model system for evolutionary studies of red algae. Like many Florideophyceae, Bostrychia has an alternation of generations between haploid gametophytes (separate male and female plants) and morphologically identical free-living diploid sporophytes (tetrasporophyte), that produce spores by meiosis [1][2].

Different Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[3] glyceraldehyde-3-phosphate dehydrogenase
  • Different life history stages (male, female, carposporophyte, and tetrasporophyte)
NA
  • F:ATGTCAAGATCCGGCGTGTA
  • R:GCCGACATTGTTGTGGAGTC
164 60 SYBR
30S[3] 30S ribosomal protein S8
  • Different life history stages (male, female, carposporophyte, and tetrasporophyte)
NA
  • F:CCAGGATTAAGAGTGTACGCAA
  • R:TCCTCCTAGCCCTAATTGCC
129 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Gwang Hoon Kim
  • Email: ghkim@kongju.ac.kr
  • Institution: Department of Biology, Kongju National University, Kongju 32588, Korea

Citation Statistics

Cited by 1 (Based on Google Scholar [2017-09-01])

References

  1. Shim J, Shim E, Kim G H, et al. Keeping house: evaluation of housekeeping genes for real-time PCR in the red alga, Bostrychia moritziana (Florideophyceae)[J]. Algae, 2016, 31(2): 167-174.
  2. Brodie, J. & Zuccarello, G. C. 2007. Systematics of the species rich algae: red algal classifcation, phylogeny and speciation. In Hodkinson, T. R. & Parnell, J. A. N. (Eds.) Reconstructing the Tree of Life: Taxonomy and Systematics of Species Rich Taxa. CRC Press, Boca Raton, FL, pp. 324-334.
  3. 3.0 3.1 Shim, Junbo, et al. Keeping house: evaluation of housekeeping genes for real-time PCR in the red alga, Bostrychia moritziana (Florideophyceae). Algae 31.2 (2016): 167-174.

Categories