Brachypodium distachyon

From ICG
Jump to: navigation, search

Description

Brachypodium distachyon.png
  • Brachypodium distachyon is a model plant because of its phylogenetic position which is more closely related to wheat and barley than to rice or maize. It is proved to be a valuable system for the study of specific processes, including dissecting the biology of the cell wall, the development of the endosperm, the controls of flowering, and the development of inflorescence. In addition, it has the usual characteristics of a model system (rapid cycling, small stature,small genome size, ease of growth)[1][2].
  • Common Name: Purple false brome
  • NCBI Taxonomy

Different Tissues & Growth Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UBC18[1] Ubiquitin-conjugating enzyme 18
  • Different tissues & development stages under various growth conditions
DV481689
  • F:GGAGGCACCTCAGGTCATTT
  • R:ATAGCGGTCATTGTCTTGCG
193 bp 60 SYBR
Ubi4[1] Polyubiquitin
  • Different tissues and growth hormone-treated samples
DV482834
  • F:TGACACCATCGACAACGTGA
  • R:GAGGGTGGACTCCTTCTGGA
126 bp 60 SYBR
Ubi10[1] Polyubiquitin
  • Different tissues and growth hormone-treated samples
DV484269
  • F:TCCACACTCCACTTGGTGCT
  • R:GAGGGTGGACTCCTTTTGGA
237 bp 60 SYBR
SamDC[1] S-adenosylmethionine decarboxylase
  • Different samples grown under various environmental stresses
DV482676
  • F:TGCTAATCTGCTCCAATGGC
  • R:GACGCAGCTGACCACCTAGA
190 bp 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Chung-Mo Park
  • Email: cmpark@snu.ac.kr
  • Institution: Department of Chemistry, Seoul National University, Seoul, 151-742, Korea

Citation Statistics

Cited by 88 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Cappelli K, Felicetti M, Capomaccio S, Spinsanti G, Silvestrelli M, Supplizi AV. Exercise induced stress in horses: selection of the most stable reference genes for quantitative RT-PCR normalization. BMC Mol Biol. 2008 May 19;9:49. doi: 10.1186/1471-2199-9-49. PubMed PMID: 18489742; PubMed Central PMCID: PMC2412902.
  2. Hong SY, Seo PJ, Yang MS, Xiang F, Park CM. Exploring valid reference genes for gene expression studies in Brachypodium distachyon by real-time PCR. BMC Plant Biol. 2008 Nov 7;8:112. doi: 10.1186/1471-2229-8-112. PubMed PMID: 18992143; PubMed Central PMCID: PMC2588586.

Categories