Brassica napus

From ICG
Jump to: navigation, search

Description

Brassica napus.png
  • Brassica napus is one of the most agriculturally important crops in the world, because of its large oilseed production. During cultivation of oilseed rape, it will be exposed to various adverse environmental conditions, including abiotic and biotic stresses, such as drought, high-salinity, and pathogens, which result in production losses. In recent years, more and more researchers have focused on gene expression studies in this crop under various exogenous stimulations to understand its defense mechanisms.
  • Common Name: Oilseed rape,Rapaseed
  • NCBI Taxonomy

Abiotic & Biotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACT7[1] Actin7
  • Heavy metal (cr 6+) stress
  • Methyl jasmonate stress
  • Abscisic acid stress
Bra028615
  • F:GCTGACCGTATGAGCAAAG
  • R:AAGATGGATGGACCCGAC
182 85.4 SYBR
SAND[1] SAND family protein
  • Cold stress
Bra000494
  • F:GCTGAAGGTGGATTGCGTG
  • R:GGAGTTTCTGGTATGCTCGGTAT
244 82.7 SYBR
UBC21[1] Ubiquitin-conjugating enzyme 21
  • Drought stress
  • Sclerotinia sclerotiorum stress
EV086936
  • F:CCTCTGCAGCCTCCTCAAGT
  • R:CATATCTCCCCTGTCTTGAAATGC
77 78.8 SYBR
PP2A[1] Protein phosphatase 2a subunit a3
  • Salt stress
  • Drought stress
  • Methyl jasmonate stress
  • Sclerotinia sclerotiorum stress
Bra012474
  • F:GTCAACAATCCGCACTACCTACA
  • R:CAACCACGACGGGAAGAAAC
112 81.4 SYBR
ZNF[1] Zinc finger protein
  • Salicylic acid stress
Bra032656
  • F:TTCAGGCGGTTTATGGC
  • R:TCGGGCTTTGCGTAGTT
168 83.4 SYBR
TIP41[1] TIP41-like Protein
  • Salt stress
  • Heavy metal (cr 6+) stress
  • Methyl jasmonate stress
  • Abscisic acid stress
  • Sclerotinia sclerotiorum stress
Bra011516
  • F:TGAAGAGCAGATTGATTTGGCT
  • R:ACACTCCATTGTCAGCCAGTT
101 78.5 SYBR
F-box[1] F-box/kelch-repeat protein
  • Cold stress
  • Salicylic acid stress
Bra006317
  • F:GAGATAAGTCGCTTCCTACCG
  • R:TGTTCCCATTGCCCTGTG
184 81.9 SYBR

Molecular Types

  • mRNA

Evaluation Methods


Contact

  • Name: Zheng Wang
  • Email: xltan@ujs.edu.cn
  • Institution: Institute of life Sciences, Jiangsu University, 301# Xuefu Road, Zhenjiang 212013, People’s Republic of china

Citation Statistics

Cited by 27 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Wang Z, Chen Y, Fang H, et al. Selection of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in Brassica napus under various stress conditions[J]. Molecular genetics and genomics, 2014, 289(5): 1023-1035.

Categories