Brassica rapa subsp. pekinensis

From ICG
Jump to: navigation, search

Description

Brassica rapa subsp. Pekinensis.png
  • Brassica rapa L. ssp. pekinensis is a subspecies of B. rapa (AA, 2n = 2x = 20) in the Cruciferae family. It is a kind of economically important biennial vegetable crop distributed in temperate and subtropical zones, especially in Asia[1]. Thousands of cultivars of Chinese cabbage are available and dozens of new cultivars are bred every year.
  • Common Name: Chinese cabbage
  • NCBI Taxonomy

Different Developmental Stages & Biotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACTIN[1] Actin2
  • Developmentalstages
AF111812
  • F:GGAGCTGAGAGATTCCGTTG
  • R:GAACCACCACTGAGGACGAT
158 60 SYBR
CyP[1] Cyclophilin
  • Developmentalstages
  • Different tissues
  • Biotic stress treatments
M55018.1
  • F:AGGAGGAGATTTCACCGC
  • R:TCTCTAACGACATCCATCCC
232 58 SYBR
Tub_a[1] Tubulin a
  • Different tissues
  • Biotic stress treatments
AC189186.2
  • F:TTTGGGTTCTCTCTTGCTAG
  • R:CGAGTAGAGAATGAGTTGAG
129 59 SYBR
UBC30[1] Ubiquitin-conjugating enzyme 30
  • Different tissues
U17250.1
  • F:TGAAAGAGCAGTGGAGCC
  • R:GGTCTGTCTTGTAGGTGTGAGC
122 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xi-Lin Hou
  • Email: hxl@njau.edu.cn
  • Institution: State Key Laboratory of Crop Genetics and Germplasm Enhancement; Horticultural College, Nanjing Agricultural University, Nanjing, Jiangsu 210095, China

Citation Statistics

Cited by 22 (Based on Google Scholar [2017-09-01])

Biotic Stress & Mycotic Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF-1-α[2] Elongation-factor-1-α
  • Heading leaves
  • Downy mildew infection leaves of seedlings
GO479260
  • F:ATACCAGGCTTGAGCATACCG
  • R:GCCAAAGAGGCCATCAGACAA
117 55~60 SYBR
GAPDH[2] Glyceraldehyde-3-phosphate dehydrogenase
  • Drought stress conditions
AF536826
  • F:CCGCTA ACTGCCTTGCTCCACTT
  • R:GCGGCTCTTCCACCTCTCCAGT
147 55~60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Fenglan Zhang
  • Email: Fenglan Zhang
  • Institution: Beijing Academy of Agriculture and Forestry Science (BAAFS), Beijing Vegetable Research Center (BVRC), Beijing 100097, China

Citation Statistics

Cited by 98 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Xiao D, Zhang N W, Zhao J J, et al. Validation of reference genes for real-time quantitative PCR normalisation in non-heading Chinese cabbage[J]. Functional Plant Biology, 2012, 39(4): 342-350.
  2. 2.0 2.1 Qi J, Yu S, Zhang F, et al. Reference gene selection for real-time quantitative polymerase chain reaction of mRNA transcript levels in Chinese cabbage (Brassica rapa L. ssp. pekinensis)[J]. Plant Molecular Biology Reporter, 2010, 28(4): 597-604.

Categories