Buglossoides arvensis

From ICG
Jump to: navigation, search

Description

Buglossoides arvensis.png
  • Buglossoides arvensis (L.), a member of the plant family Boraginaceae, commonly referred to as corn grom-well, or more recently as Ahiflower, this weed plant has evoked high interest amongst researchers for its nutraceutical value. Ahiflower oil is a dietary oil rich in stearidonic acid (20% SDA; 18:4 n-3). The SDA-rich Ahiflower oil (45% ALA, 20% SDA) extracted from the seed of Buglossoides arvensis is more efficient than ALA-rich flaxseed oil (60% ALA) at increasing serum, erythrocyte, mononuclear cell and neutrophil EPA and docosapentaenoic acid (DPA, 22:5 n-3) contents[1] [2].
  • Common Name: Field gromwell,Corn gromwell,Bastard alkanet, Ahiflower
  • NCBI Taxonomy

Different Tissues & Growth Regimes

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
CAC[1] Clathrin adaptor complexes
  • Leaves, stems, flowers and seeds
  • Inoculation and temperature treatments
KJ883539
  • F:TTGACTGTTTGGTTTGGAAGATAAGA
  • R:TTCCACCTCAGCACTCAATGTAG
NA 60 SYBR
α-tub[1] Alpha tubulin
  • Leaves, stems, flowers and seeds
  • Inoculation and temperature treatments
KJ920355
  • F:CCTGAGAAACAAGCCTGTTGAGA
  • R:CGCAAGTCCCTCGACATTG
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Martin Filion
  • Email: martin.filion@umoncton.ca
  • Institution: Department of Biology, Université de Moncton, 18 Antonine-Maillet Ave, Moncton, NB E1A 3E9, Canada

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Gadkar VJ, Filion M (2015) Validation of endogenous reference genes in Buglossoides arvensis for normalizing RT-qPCR-based gene expression data. Springerplus 4, 178.
  2. Lefort N, Le Blanc R, Surette ME (2017) Dietary Buglossoides Arvensis Oil Increases Circulating n-3 Polyunsaturated Fatty Acids in a Dose-Dependent Manner and Enhances Lipopolysaccharide-Stimulated Whole Blood Interleukin-10-A Randomized Placebo-Controlled Trial. Nutrients 9.

Categories