Caenorhabditis elegans

From ICG
Jump to: navigation, search

Description

Caenorhabditis elegans.png
  • Caenorhabditis elegans, a free-living nematode that feeds on soil microorganisms, is the most abundant soil-dwelling invertebrate that occupied a key position in terrestrial ecosystem by influencing energy transfer and nutrient cycling. It is a simple multicellular eukaryote with its genome first completely sequenced and its cell lineage well described. As a simple and welldefined genetic model, C. elegans has gained increasing popularity among scientists to study the molecular mechanism of emerging materials[1][2].
  • Common Name: Worm,Nematode
  • NCBI Taxonomy

Nanotoxicity

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
tba-1[1] Tubulin, alpha family member
  • Nanoparticle-induced genetic response
NA
  • F:TCAACACTGCCATCGCCGCC
  • R:TCCAAGCGAGACCAGGCTTCAG
NA 60 SYBR
Y45F10D.4[1] Putative iron-sulfur cluster assembly enzyme
  • Nanoparticle-induced genetic response
NA
  • F:ATCAGATACCGTCGTAGTTC
  • R:TTCCGTCAATTCCTTTAAG
NA 60 SYBR
pmp-3[1] Peroxisomal membrane protein related
  • Nanoparticle-induced genetic response
NA
  • F:TGGCCGGATGATGGTGTCGC
  • R:ACGAACAATGCCAAAGGCCAGC
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yanqiong Zhang
  • Email: Panx@ecu.edu
  • Institution: Department of Biology, East Carolina University, Greenville, North Carolina, United States of America

Citation Statistics

Cited by 69 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Zhang Y, Chen D, Smith M A, et al. Selection of reliable reference genes in Caenorhabditis elegans for analysis of nanotoxicity[J]. PloS one, 2012, 7(3): e31849.
  2. Murray AR, Kisin E, Leonard SS, Young SH, Kommineni C, et al. Oxidative stress and inflammatory response in dermal toxicity of single-walled carbon nanotubes. Toxicology 257: 161–171.

Categories