Cajanus cajan

From ICG
Jump to: navigation, search

Description

Cajanus cajan.png
  • Cajanus cajan is a perennial legume from the family Fabaceae. It is a perennial shrub distributed in the tropics and subtropics of Asia, Africa and the Americas, and known as pigeon pea. It is grown in low-input and risk-prone marginal environments and is often subjected to water stress at different stages of growth and development. In China, its leaves are used as a folk medicine to relieve swelling and pain, kill parasites and treat varicella[1] [2].
  • Common Name: Pigeon pea
  • NCBI Taxonomy

Drought Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
IF4α[1] Initiation factor 4a
  • Root, stem and leaves tissues
  • Drought stress
KYP62254.1
  • F:GCCGAGATCACACAGTCTCA
  • R:ACCACGAGCCAAAAGATCAG
125 95 SYBR
TUB6[1] Tubulin/FtsZ family, GTPase domain
  • Root, stem and leaves tissues
  • Drought stress
KHN09085.1
  • F:GCCCTGACAACTTCGTCTTC
  • R:GCAGTTTTCAGCCTCTTTGC
100 60 SYBR
HSP80[1] Heat shock protein 80
  • Root, stem and leaves tissues
  • Drought stress
KYP49760.1
  • F:TGTCGAGCAAGAAGACGATG
  • R:GGGCAGTTTCAAAGAGCAAG
103 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Rajeev K. Varshney
  • Email: r.k.varshney@cgiar.org
  • Institution: International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Hyderabad, 502324, India

Citation Statistics

Cited by 17 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Sinha P, Singh VK, Suryanarayana V, et al. (2015) Evaluation and validation of housekeeping genes as reference for gene expression studies in pigeonpea (Cajanus cajan) under drought stress conditions. PLoS One 10, e0122847.
  2. Tang R, Tian RH, Cai JZ, et al. (2017) Acute and sub-chronic toxicity of Cajanus cajan leaf extracts. Pharm Biol 55, 1740-1746.

Categories