Callithrix jacchus

From ICG
Jump to: navigation, search

Description

Callithrix jacchus-1.jpg
  • Callithrix jacchus is a small New World primate that is native to eastern Brazil and has been employed in recent biomedical studies in, for example, reproductive biology, infectious disease and drug development. In particular, marmosets have been used for neuroscience and behavioral studies, such as, pathological studies of Alzheimer's disease, Parkinson's disease, Huntington's disease, Multiple sclerosis and studies of anxiety and stress [1].
  • Common Name: Common marmoset
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RN18S1[1] 18S ribosomal RNA
  • Thyroid,thymus, heart
  • Lung, liver, adrenal
  • Gland, kidney, spleen stomach
  • Small intestine, colon and muscle
AB571241
  • F:CGCGGTTCTATTTTGTTGGT
  • R:AGTCGGGCATCGTTTATGGTC
219 62 SYBR
RPLP0[1] Ribosomal protien,large, PO
  • Thyroid,thymus, heart
  • Lung, liver, adrenal
  • Gland, kidney, spleen stomach
  • Small intestine, colon and muscle
XM_002753074
  • F:GCTCAACATCTCTCCCTTCTCCT
  • R:GCTCAACATCTCTCCCTTCTCCT
140 60 SYBR
ACTB[1] b-Actin
  • Brain areas (cerebral cortex, striatum, hippocampus, thalamus and cerebellum)
DD279463
  • F:AGCAGTCGGTTGGAGCGAGCAT
  • R:TGGCTTTTGGGAGGGCAAGGGA
139 62 SYBR
PPIA[1] Peptidylprolyl isomerace (Cyclophilin) A
  • Brain areas (cerebral cortex, striatum, hippocampus, thalamus and cerebellum)
ENSCJAT00000023248
  • F:TGCTGGACCCAACAGAAACGGT
  • R:AAAGCGCTCCATGGCCTCCA
130 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Hiroshi Kitamura
  • Email: ktmr@med.nagoya-cu.ac.jp
  • Institution: Department of Comparative and Experimental Medicine, Graduate School of Medical Sciences, Nagoya City University, Kawasumi 1, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japan

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Shimamoto Y, Kitamura H, Niimi K, Yoshikawa Y, Hoshi F, Ishizuka M, Takahashi E. Selection of suitable reference genes for mRNA quantification studies using common marmoset tissues. Mol Biol Rep. 2013 Dec;40(12):6747-55. doi: 10.1007/s11033-013-2791-0. Epub 2013 Sep 26. PubMed PMID: 24068436.

Categories