Canis lupus familiaris

From ICG
Jump to: navigation, search

Description

Canis lupus familiaris.png
  • Canis lupus familiaris, as a member of genus Canis (canines) that forms part of the wolf-like canids, is the most widely abundant carnivore. Pet domestic dogs are highly responsive to human actions and attentional states[1][2].
  • Common Name: Domestic dog
  • NCBI Taxonomy

Different Disease Groups & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPL13A[1] Ribosomal protein L13a
  • Bone marrow, colon, duodenum
  • Heart, kidney, liver, lung
  • Lymph node, skeletal muscle
  • Pancreas, spleen, stomach
AJ388525
  • F:GCCGGAAGGTTGTAGTCGT
  • R:GGAGGAAGGCCAGGTAATTC
87 85 SYBR
RPL32[1] Ribosomal protein L32
  • Bone marrow, colon, duodenum
  • Heart, kidney, liver, lung
  • Lymph node, skeletal muscle
  • Pancreas, spleen, stomach
XM_848016.1
  • F:TGGTTACAGGAGCAACAAGAAA
  • R:GCACATCAGCAGCACTTCA
100 87 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Iain R. Peters
  • Email: I.R.Peters@Bristol.ac.uk
  • Institution: School of Clinical Veterinary Science, University of Bristol, Langford House, Langford, Bristol BS40 5DU, UK

Citation Statistics

Cited by 127 (Based on Google Scholar [2017-09-01])

Different Developmental Stages & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPS5[3] Ribosomal protein S5
  • Whole brain
  • Whole body tissues
  • Forebrain and cerebrum
XM_533568
  • F:GGATGACCGAGTGGGAGA
  • R: TGCAATGTAGTCCTGCAAAGA
122 60 SYBR
RPL8[3] Ribosomal protein L8
  • Whole body tissues
XM_532360
  • F:AGGTCATTTCTTCCGCCAA
  • R: AGGATGCTCCACAGGATTCA
164 60 SYBR
RPS19[3] Ribosomal protein S19
  • Forebrain and cerebrum
  • Diencephalon
  • Hindbrain
XM_533657
  • F:GTGAACCAGCAGGAGTTCGT
  • R:GGAGGTACAGGTGCCGTG
175 60 SYBR
RPL32[3] 60S Ribosomal protein L32
  • Diencephalon
XM_844472
  • F:ATCGCTGGTTGGCTCAGTAG
  • R:AGAGAGAGGCAGAGACGGTG
112 60 SYBR
GAPDH[3] Glyceraldehyde-3-phospate dehydrogenase
  • Hindbrain
NM_001003142
  • F:CACAGTCAAGGCTGAGAACG
  • R:CACCAGCATCACCCCATTT
101 60 SYBR
MRPS7[3] Mitochondrial ribosomal protein S7
  • Metencephalon
XM_846915
  • F: GATCCCTCATGATGCAGACTC
  • R: GGCACAGGGACCTGATAAAA
196 60 SYBR
RPL13A[3] Ribosomal protein L13A
  • Metencephalon
AJ388525
  • F:AGGTTGTAGTCGTGCGCTGT
  • R: CATGCCTCTAACTGTCCGC
167 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Kyu-Tae Chang
  • Email: changkt@kribb.re.kr
  • Institution: National Primate Research Center, Korea Research Institute of Bioscience and Biotechnology, Ochang, Chungbuk 363-883, Republic of Korea

Citation Statistics

Cited by 13 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Peters IR, Peeters D, Helps CR, Day MJ. Development and application of multiple internal reference (housekeeper) gene assays for accurate normalisation of canine gene expression studies. Vet Immunol Immunopathol. 2007 May 15;117(1-2):55-66. Epub 2007 Jan 31. PubMed PMID: 17346803.
  2. Lazarowski L, Dorman DC. A comparison of pet and purpose-bred research dog (Canis familiaris) performance on human-guided object-choice tasks. Behav Processes. 2015 Jan;110:60-7. doi: 10.1016/j.beproc.2014.09.021. Epub 2014 Sep 20. PubMed PMID: 25245303.
  3. 3.0 3.1 3.2 3.3 3.4 3.5 3.6 Park SJ, Huh JW, Kim YH, Lee SR, Kim SH, Kim SU, Kim HS, Kim MK, Chang KT. Selection of internal reference genes for normalization of quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis in the canine brain and other organs. Mol Biotechnol. 2013 May;54(1):47-57. doi: 10.1007/s12033-012-9543-6. PubMed PMID: 22531949.

Categories