Caragana korshinskii

From ICG
Jump to: navigation, search

Description

Caragana korshinskii.png
  • Caragana korshinskii, a leguminous shrub species, is a native desert shrub with strong drought-resistance, sand-fixing capacity and high forage value that is widespread in the desert land of west and northwest China, is commonly found in arid and semi-arid lands in northwestern China. C. korshinskii, Hedysarum scoparium Fisch., and Artemisia ordosica Kracsh. were the main species initially employed for vegetation restoration in desert areas in China[1].
  • Common Name: Peashrub
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Drought, heat, cold, salt
  • ABA and high pH treatment
KC679843
  • F:GCATTCCGTGTACCTACTCCCA
  • R:CAACATCCTCGTCTGTGTATCCA
151 60 SYBR
EF1a[1] Elongation factor 1-alpha-like
  • Drought, heat, cold, salt
  • ABA and high pH treatment
KC679842
  • F:CAAAAAGTCCCCTCGTTGTCTC
  • R:AGCAATCGTTCTTCCTAATGATCTAA
142 60 SYBR
SKIP5-1[1] F-box protein SKIP5-1-like
  • Drought, heat, cold, salt
  • ABA and high pH treatment
KC679845
  • F:GCTTCCTTCCCCCTATTCCAG
  • R:AAAACACCAGGTTCAGATAAGTCTTTG
133 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Guojing Li
  • Email: liguojing@imau.edu.cn
  • Institution: College of Life Sciences, Inner Mongolia Agricultural University, Hohhot 010018, People's Republic of China

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Yang Q, Yin JJ, Li G, et al. (2014) Reference gene selection for qRT-PCR in Caragana korshinskii Kom. under different stress conditions. Molecular Biology Reports 41, 2325-2334.

Categories