Carica papaya

From ICG
Jump to: navigation, search

Description

Carica papaya.png
  • Carica papaya L. is the only species within the genus Carica and the most commercially important species within the family Caricaceae and it has been widely cultivated in tropical and subtropical lowland regions for its nutritional benefits and medicinal applications. Papaya is also the first perennial transgenic fruit variety for commercial application of the world. However, papaya fruit is subject to some problems such as rapid ripening, susceptible to biotic or abiotic stresses, which could result in a high percentage of product loss[1][2].
  • Common Name: Papaya
  • NCBI Taxonomy

Different Experimental Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EIF[1] Eukaryotic initiation factor 4A
  • Various tissues
  • Different storage temperatures
  • Different cultivars
  • Developmental stages
  • Postharvest ripening
  • Modified atmosphere packaging
  • 1-methylcyclopropene (1-MCP) treatment
  • Hot water treatment
  • Biotic stress and hormone treatment
FJ644949.1
  • F:AGGCAGGCAAGAGAAGAT
  • R:TTCATACCGAGTAGCGATTC
176 81.5 SYBR
TBP1[1] TATA binding protein 1
  • Various tissues
  • Different storage temperatures
  • Different cultivars
  • Developmental stages
  • Postharvest ripening
  • Modified atmosphere packaging
  • 1-methylcyclopropene (1-MCP) treatment
  • Hot water treatment
  • Biotic stress and hormone treatment
JQ678780
  • F:GGTAGTAGTAGTTAGGTATGTG
  • R:GGCAATCTGGTCTCACTT
219 79.5 SYBR
TBP2[1] TATA binding protein 2
  • Various tissues
  • Different storage temperatures
  • Different cultivars
  • Developmental stages
  • Postharvest ripening
  • Modified atmosphere packaging
  • 1-methylcyclopropene (1-MCP) treatment
  • Hot water treatment
  • Biotic stress and hormone treatment
JQ678779
  • F:TGTGAATACTGGTGCTGAG
  • R:GGCATGAGACAAGACCTATA
104 80 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiaoyang Zhu
  • Email: lxp280477@yahoo.cn
  • Institution: Guangdong Key Laboratory for Postharvest Science and Technology, College of Horticulture, South China Agricultural University, Guangzhou, P.R. China

Citation Statistics

Cited by 99 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Zhu X, Li X, Chen W, et al. Evaluation of new reference genes in papaya for accurate transcript normalization under different experimental conditions[J]. PloS one, 2012, 7(8): e44405.
  2. Hu R, Fan C, Li H, Zhang Q, Fu YF (2009) Evaluation of putative reference genes for gene expression normalization in soybean by quantitative real-time RT-PCR. BMC Molecular Biology 10: 93.

Categories