Casuarina glauca

From ICG
Jump to: navigation, search

Description

Casuarina glauca.png
  • Casuarina glauca is a model actinorhizal plant species that are able to establish root-nodule symbiosis with N 2 -fixing Frankia bacteria and are often pioneer on nitrogen-poor sites. This plant is of great economic and ecological relevance because it is highly resilient to extreme environments (drought and high salinity). C.glauca trees are frequently used to colonize, enrich and recover poor sites and reshape the global landscape. It is also considered as the model of actinorhizal plants due to the availability of a genetic transformation system and the extensive research basis of symbiosis with Frankia and mycorrhiza[1] [2].
  • Common Name: Swamp she-oak,Swamp oak,Grey oak,River oak
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ap47[1] Clathrin adaptor complexes subunit
  • Branchlets & nodules
FQ318589.1
  • F:TCTTGAGGGTGAAATCGTTCG
  • R:TGATGCATAGCGCCTGTATAC
NA 60 Luminaris HiGreen
PP2A[1] Serine threonine protein phosphatase
  • Branchlets
FQ365636
  • F:AATAGGCCGGTAAGCTCGAA
  • R:ACATCCCTGAATCCTGGCAA
NA 60 Luminaris HiGreen
S23[1] 40S ribosomal protein
  • Roots & nodules
FQ318261
  • F:GCTGGATCATCTCATGCAAA
  • R:CAAAAGCCGCAATCTTCTTC
NA 60 Luminaris HiGreen
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Roots
FQ312704.1
  • F:CACTTGAAGGGAGGTGCAAAG
  • R:GTGCAGCTAGCATTGGAGATG
NA 60 Luminaris HiGreen

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ana I. Ribeiro-Barros
  • Email: aribeiro@itqb.unl.pt
  • Institution: Grupo Interações Planta-Ambiente & Biodiversidade (PlantStress&Biodiversity), Instituto de Investigação Científica Tropical, Universidade de Lisboa, Av. República, Quinta do Marquês, 2784-505 Oeiras, Portugal

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 da Costa M, Duro N, Batista-Santos P, Ramalho JC, Ribeiro-Barros AI (2015) Validation of candidate reference genes for qRT-PCR studies in symbiotic and non-symbiotic Casuarina glauca Sieb. ex Spreng. under salinity conditions. Symbiosis 66, 21-35.
  2. Pawlowski K, Demchenko KN (2012) The diversity of actinorhizal symbiosis. Protoplasma 249, 967-979.

Categories