Channa striatus

From ICG
Jump to: navigation, search

Description

Channa striatus.png
  • Channa striata is a species of the fresh water snakehead fish of Channidae family that normally resides in a temperature of 25–27℃. It is native to South and Southeast Asia and have long been regarded as valuable fish in far East. It has also been introduced to some Pacific Islands. Striped snakehead is a obligatory air-breathing carnivorous fish that were once considered a pest or as a means to control unwanted fry and fingerlings production from tilapia or carp in aquaculture ponds.[1] [2].
  • Common Name: Snakehead murrel,Common snakehead,Chevron snakehead,Striped snakehead
  • NCBI Taxonomy

High-temperature Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
tub[1] alpha-tubulin
  • Liver and gill tissues under both short- and long-term thermal stress
KC710731
  • F:CCTGCTGGGAACTGTATTGT
  • R:TCAATGAGTTCCTTGCCAAT
89 54 SYBR
β-actin[1] beta-actin
  • Liver, gill and lmuscle tissues under both short- and long-term thermal stress
KC967219
  • F:GCCTTCCTTCCTTGGTATGG
  • R:GTGTTGGCGTACAGGTCCTT
89 59 SYBR
gapdh[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Lmuscle tissues under both short- and long-term thermal stress
KF044311
  • F:ATCAAGGAAGCGGTGAAGAAGG
  • R:CGAAGATGGAGGAGTGGGTGTC
99 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Sasmita Mohanty
  • Email: smohanty@kiitbiotech.ac.in
  • Institution: KIIT School of Biotechnology, KIIT University, Bhubaneswar, Odisha 751024, India

Citation Statistics

Cited by 8 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Purohit GK, Mahanty A, Mohanty BP, Mohanty S (2016) Evaluation of housekeeping genes as references for quantitative real-time PCR analysis of gene expression in the murrel Channa striatus under high-temperature stress. Fish Physiol Biochem 42, 125-135.
  2. Muntaziana AMP, Amin SMN, Kamarudin MS, Rahim A, Romano N (2017) Feeding frequency influences the survival, growth and body lipid content of striped snakehead, Channa striatus (Bloch) fry. Aquaculture Research 48, 2602-2606.

Categories