Siniperca chuatsi

Description

Siniperca chuatsi is one of the most commercially important carnivorous fish species in China as well as in eastern Asia. Its back is yellow, green, or brown, with many irregular black spots and patches. It is an inhabitant of rivers with big mouth and small round scales. It can reach up to 70 cm (28 in) in total length, and the greatest recorded weight is 10.2 kg (22 lb). Mandarin fish's broad adaptive capacity to diverse conditions and the swiftness under broad temperature range are supposedly due to different isoforms of muscle proteins^[1] ^[2].
Common Name: Mandarin fish, Chinese perch
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
miR-22a^[1]	miR-22a	Brain, kidney, liver, spleen, heart, intestine, red muscle and white muscle Different post-embryonic development stages Embryos at the two-cell stage, blastula stage, gastrula stage, neurula stage, tail-bud stage, muscular effect stage, heart beating stage and larval stage Fasting and refeeding	NA	F:AAGCUGCCAGCUGAAGAACUGU R:AGCTGCCAGCTGAGACTGT	NA	60	SYBR
miR-23a^[1]	miR-23a	Brain, kidney, liver, spleen, heart, intestine, red muscle and white muscle Different post-embryonic development stages Embryos at the two-cell stage, blastula stage, gastrula stage, neurula stage, tail-bud stage, muscular effect stage, heart beating stage and larval stage Fasting and refeeding	NA	F:AUCACAUUGCCAGGGAUUUCCA R:CATCACATTGCCAGGGATTTC	NA	60	SYBR

Name: Wu-Ying Chu
Email: chuwuying18@163.com
Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India

Cited by 11 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 Zhu X, Li YL, Chen DX, et al. (2015) Selection of reference genes for microRNA quantitative expression analysis in Chinese perch, Siniperca chuatsi. Int J Mol Sci 16, 8310-8323.
↑ Zhang G, Chu W, Hu S, et al. (2011) Identification and analysis of muscle-related protein isoforms expressed in the white muscle of the mandarin fish (Siniperca chuatsi). Mar Biotechnol (NY) 13, 151-162.