Chrysanthemum lavandulifolium

From ICG
Jump to: navigation, search

Description

Chrysanthemum lavandulifolium.png
  • Chrysanthemum lavandulifolium, one of the 10 most well-known Chinese traditional flowers, is composed of the most abundant and various cultivars among the horticultural plants around the world. The petal types of chrysanthemums were classified into five groups containing flat, tubular, spoon, abnormal, and anemone.
  • Herbs, perennial. Stems 30-150 cm, erect, corymbosely branched above middle or only in upper part, pilose, especially in upper part and on synflorescence branches. Basal and lower stem leaves withered by anthesis; middle stem leaves: petiole 0.5-1 cm; leaf blade ovate, broadly ovate, elliptic-ovate, narrowly elliptic, or ovate-lanceolate, 2-7 × 1.5-4.5 cm, surfaces concolorous or nearly so, 2-pinnatisect, 2-pinnatipartite, or inconspicuously 2-pinnatipartite; primary lateral segments 2 or 3(or 4) pairs; ultimate lobes elliptic. Upper stem leaves small, tripartite or entire[1] [2].
  • Common Name: Gan ju
  • NCBI Taxonomy

Flower Development

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
SAND[1] SAND family protein
  • Flower development
  • Leaves
NA
  • F:CGTTGCTCACTACGAGTTCAC
  • R:GCAGATGGGTCAACAGGTAA
178 62.1 SYBR
PGK[1] Phosphoglycerate kinase
  • Flower Development
  • Leaves
NA
  • F:ATACCTAATGGACGAAGAGA
  • R:TTATTGTCGTCTTTACTACCA
248 64.1 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Silan Dai
  • Email: silandai@sina.com
  • Institution: College of Landscape Architecture, Beijing Forestry University, Beijing, China

Citation Statistics

Cited by 11 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Qi S, Yang L, Wen X, et al. (2016) Reference Gene Selection for RT-qPCR Analysis of Flower Development in Chrysanthemum morifolium and Chrysanthemum lavandulifolium. Front Plant Sci 7, 287.
  2. Hu P, Niu J, Yu M, Lin S-Y (2017) Facile Solvothermal Synthesis of Reduced Graphene Oxide-BiPO 4 Nanocomposite with Enhanced Photocatalytic Activity. Chinese Journal of Analytical Chemistry 45, 357-362.

Categories