Chrysanthemum morifolium

From ICG
Jump to: navigation, search

Description

Chrysanthemum morifolium.png
  • Chrysanthemum morifolium is one of the 10 most well-known Chinese traditional flowers, the cultivation of Chuju in China has lasted about two thousand years. It is the China national geographical indication product and composed of the most abundant and various cultivars among the horticultural plants around the world. The petal types of chrysanthemums were classified into five groups containing flat, tubular, spoon, abnormal, and anemone. Currently, it has been approved as pharmaceutical/food resource by the Ministry of Health of China as it contains flavonoids, polysaccharides, polyphenols and other substances[1] [2].
  • Common Name: Florist's daisy, Chuju
  • NCBI Taxonomy

Flower Development

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
SAND[1] SAND family protein
  • Two florets and the different petal types
NA
  • F:CGTTGCTCACTACGAGTTCAC
  • R:GCAGATGGGTCAACAGGTAA
178 62.1 SYBR
PGK[1] Phosphoglycerate kinase
  • Two florets and the different petal types
NA
  • F:ATACCTAATGGACGAAGAGA
  • R:TTATTGTCGTCTTTACTACCA
248 64.1 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Silan Dai
  • Email: silandai@sina.com
  • Institution: College of Landscape Architecture, Beijing Forestry University, Beijing, China

Citation Statistics

Cited by 11 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Qi S, Yang L, Wen X, et al. (2016) Reference Gene Selection for RT-qPCR Analysis of Flower Development in Chrysanthemum morifolium and Chrysanthemum lavandulifolium. Front Plant Sci 7, 287.
  2. Hu P, Niu J, Yu M, Lin S-Y (2017) Facile Solvothermal Synthesis of Reduced Graphene Oxide-BiPO 4 Nanocomposite with Enhanced Photocatalytic Activity. Chinese Journal of Analytical Chemistry 45, 357-362.

Categories