Cicer arietinum

From ICG
Jump to: navigation, search

Description

Cicer arietinum.png
  • Cicer arietinum is an important food legume of the semi-arid tropical (SAT) regions of the world, known to be a health benefiting food because of its high nutritional value. Despite growing demand and high yield potential, its unstable yield and productivity is stagnant at unacceptably low levels due to constraints such as abiotic stresses (drought, heat, cold and high-salinity) and biotic stresses (Ascochyta blight, Fusarium wilt and pod borer). Cultivation with sodium metavanadate, sodium chloride or sodium sulfate in the early stage can increase its concentration of formononetin, ononin, daidzein and biochanin A glucoside contents [1] [2] [3].
  • Common Name: Chickpea
  • NCBI Taxonomy

Across Cultivated and Wild Species

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UCP[1] Uncharacterized conserved protein
  • Across different genotypes
XM_004505295
  • F:TGGAGCCCAATTACAAAAGC
  • R:TTTGAAGCCAAAGAGGCAAC
138 62 SYBR
G6PD[1] Glucose-6-phosphate 1-dehydrogenase
  • Across different genotypes
XM_004515773
  • F:ACAACGATACCAGGGTGTTACC
  • R:TCTCCCATGATGCCTTTAACTC
116 62 SYBR
TIP41[1] Tonoplast intrinsic proteins -like protein
  • Abiotic stress conditions
XM_004496854
  • F:GTTGTACTTCGGGAGAGTTGCT
  • R:GGAGCTTCTGGCTTATGATGCT
115 62 SYBR
ABCT[1] ATP-binding cassette transporter
  • Universal reference gene
XM_004505589
  • F:TCACAGGTTGTGATGGAGTCTG
  • R:CCTCAAATCTTGTTGGGGTGTC
135 62 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pooja Bhatnagar-Mathur
  • Email: p.bhatnagar@cgiar.org
  • Institution: Genetic Transformation Laboratory, International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru-502324, Telangana, India

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-09-01])

Different Developmental Stages & Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1α[2] Elongation factor 1-alpha
  • Various organs developmental stages
  • Various stress conditions
AJ004960
  • F:TCCACCACTTGGTCGTTTTG
  • R:CTTAATGACACCGACAGCAACAG
64 60 SYBR
HSP90[2] Heat shock protein 90
  • Various organs developmental stages
GR406804
  • F:GCAGCATGGCTGGTTACATGT
  • R:GCAGCATGGCTGGTTACATGT
63 60 SYBR
GAPDH[2] Glyceraldehyde-3-phosphate dehydrogenase
  • Various stress conditions
AJ010224
  • F:CCAAGGTCAAGATCGGAATCA
  • R:CAAAGCCACTCTAGCAACCAAA
65 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Mukesh Jain
  • Email: mjainanid@gmail.com
  • Institution: National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, New Delhi 110 067, India

Citation Statistics

Cited by 104 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Reddy DS, Bhatnagar-Mathur P, Reddy PS, et al. (2016) Identification and Validation of Reference Genes and Their Impact on Normalized Gene Expression Studies across Cultivated and Wild Cicer Species. PLoS One 11, e0148451.
  2. 2.0 2.1 2.2 2.3 Garg R, Sahoo A, Tyagi A K, et al. Validation of internal control genes for quantitative gene expression studies in chickpea (Cicer arietinum L.)[J]. Biochemical and biophysical research communications, 2010, 396(2): 283-288.
  3. Guardado-Felix D, Serna-Saldivar SO, Cuevas-Rodriguez EO, Jacobo-Velazquez DA, Gutierrez-Uribe JA (2017) Effect of sodium selenite on isoflavonoid contents and antioxidant capacity of chickpea (Cicer arietinum L.) sprouts. Food Chem 226, 69-74.

Categories