Cichorium intybus

From ICG
Jump to: navigation, search

Description

Cichorium intybus.png
  • Cichorium intybus L. var sativum is a member of the Asteraceae family widely used for inulin production in northwestern Europe, India, South Africa, and Chile. Its roots are processed to prepare dried or roasted products or beverages. It accumulates four major polyphenols: chlorogenic, isochlorogenic, caftaric, and chicoric acids. It is widely used medicinally to treat various ailments ranging from wounds to diabetes, although many of its constituents have not been explored for their pharmacological potential. Toxicological data on C. intybus is currently limited[1] [2].
  • Common Name: Common chicory
  • NCBI Taxonomy

Growth Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
TIP41[1] TIP41 like protein
  • Cell cultures grown under various conditions
EH681285.1
  • F:GTTGGGTGCGCATCTCTAAT
  • R:AGCTCCGGCAGCTTTTACTT
100 84 SYBR
Clath[1] Clathrin adaptator complex subunit
  • Seedlings
EH684142.1
  • F:TGCTTCCGCCATCTACTTTT
  • R:TCCCAAGTTCCTTTGTTTGC
128 80.5 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: David Gagneul
  • Email: david.gagneul@univ-lille1.fr
  • Institution: Université Lille, INRA, ISA, Université d'Artois, Université du Littoral Côte d'Opale, EA 7394- ICV -Institut Charles Viollette, Lille, France

Citation Statistics

Cited by 14 (Based on Google Scholar [2017-09-01])

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT[2] Actin
  • Chicory root and leaf tissues
EF528575
  • F:CCAAATCCAGCTCATCAGTCG
  • R:TCTTTCGGCTCCGATGGTGAT
74 80.26 SYBR
EF[2] Elongation factor 1-alpha
  • Chicory root and leaf tissues
AY378166
  • F:CATGCGTCAGACGGTTGCTGT
  • R:CTTCACTCCCTTCTTGGCTGC
100 82.17 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Marc De Loose
  • Email: marc.deloose@ilvo.vlaanderen.be
  • Institution: Institute for Agricultural and Fisheries Research (ILVO), Burg Van Gansberghelaan 115 bus 1, 9820 Merelbeke, Belgium

Citation Statistics

Cited by 168 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Delporte M, Legrand G, Hilbert JL, Gagneul D (2015) Selection and validation of reference genes for quantitative real-time PCR analysis of gene expression in Cichorium intybus. Front Plant Sci 6, 651.
  2. 2.0 2.1 2.2 Maroufi A, Van Bockstaele E, De Loose M. Validation of reference genes for gene expression analysis in chicory (Cichorium intybus) using quantitative real-time PCR[J]. BMC molecular biology, 2010, 11(1): 15.

Categories