Citrus clementina

From ICG
Jump to: navigation, search

Description

Citrus clementina.png
  • Citrus clementina is a hybrid between mandarin orange and sweet orange which was so named in 1902. The exterior is a deep orange colour with a smooth, glossy appearance. Clementines can be separated into 7 to 14 segments. Similar to tangerines, they tend to be easy to peel. About 82 % of them were tri-haploids, rather than haploids or doubled-haploids, but embryos with other ploidy levels, such as n, 2n, 4n and 6n, were also obtained[1][2].
  • Common Name: Clementine
  • NCBI Taxonomy

Different Genotypes

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18SrRNA[1] 18S ribosomal RNA
  • Diverse cultivars and tissues
FJ356261
  • F:TCGGGTGTTTTCACGTCTCA
  • R:TGGATGCCGCTGGGAAGC
120 58 SYBR
ACTB[1] Beta actin
  • Diverse cultivars and tissues
CB250364
  • F:CCAATTCTCTCTTGAACCTGTCCTT
  • R:GAAGACCGTCAAGAGTAGTCAGT
120 58 SYBR
rpII[1] RNA polymerase II
  • Diverse cultivars and tissues
ET098196
  • F:CACTGCTCTGCTTTCCTTCCAT
  • R:AACTGCCCACTATTCTCGTCTC
120 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ziniu Deng
  • Email: deng7009@163.com
  • Institution: Horticulture and Landscape College, Hunan Agricultural University, Furong District, Changsha 410128, Hunan, China

Citation Statistics

Cited by 80 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Yan J, Yuan F, Long G, et al. Selection of reference genes for quantitative real-time RT-PCR analysis in citrus[J]. Molecular biology reports, 2012, 39(2): 1831-1838.
  2. Cardoso, J.C., Martinelli, A.P., Germanà, M.A. et al.In vitro anther culture of sweet orange (Citrus sinensis L. Osbeck) genotypes and of a C. clementina × C. sinensis ‘Hamlin’ hybrid. Plant Cell Tiss Organ Cult (2014) 117: 455.

Categories