Citrus japonica

From ICG
Jump to: navigation, search

Description

Citrus japonica.png
  • Citrus japonica belongs to Fortunella which is a closely related genus to Citrus. It can flower several times per year, its juvenile phase is significantly shorter than that of other Citrus species. It is originated in China and produces edible fruit of various shapes with immense global production. As one of the most important fruit crops worldwide, Kumquats provide an excellent source of nutrients and phytochemicals, including ascorbic acid, carotenoids, flavonoids and essential oils. Besides, it has also been used in traditional herbal medicine, especially for colds and coughs[1][2].
  • Common Name: Kumquats
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT7[1] Actin 7
  • Salt & drought & heavy metal stress
Cs7g29220.3
  • F:CTGGCTTACATCGCTCTTGA
  • R:GCCCATCAGGCAACTCATAG
91 80.5 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xinhua
  • Email: honest66222@163.com
  • Institution: College of Agriculture, Guangxi University, 100 Daxue Road, Nanning 530004, PR China

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 Hu Y, Chen H, Luo C, et al. (2014) Selection of reference genes for real-time quantitative PCR studies of kumquat in various tissues and under abiotic stress. Scientia Horticulturae 174, 207-216.
  2. Wang YW, Zeng WC, Xu PY, et al. (2012) Chemical Composition and Antimicrobial Activity of the Essential Oil of Kumquat (Fortunella crassifolia Swingle) Peel. International Journal of Molecular Sciences 13, 3382-3393.

Categories