Citrus maxima

From ICG
Jump to: navigation, search

Description

Citrus maxima.png
  • Citrus maxima is a medium-sized tree but the largest of all Citrus species, with large leaves, flowers, and fruits. It is a citrus fruit native to South East Asia with a considerable quantity of peel waste generated in both Thailand and Malaysia. Due to the high domestic consumption and export demand, it has recently been considered as a potential source of pectin[1][2].
  • Common Name: Pomelo, Pomello, Pummelo, Pamplemousse, Jabong
  • NCBI Taxonomy

Different Genotypes

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18SrRNA[1] 18S ribosomal RNA
  • Diverse cultivars and tissues
FJ356261
  • F:TCGGGTGTTTTCACGTCTCA
  • R:TGGATGCCGCTGGGAAGC
120 58 SYBR
ACTB[1] Beta actin
  • Diverse cultivars and tissues
CB250364
  • F:CCAATTCTCTCTTGAACCTGTCCTT
  • R:GAAGACCGTCAAGAGTAGTCAGT
120 58 SYBR
rpII[1] RNA polymerase II
  • Diverse cultivars and tissues
ET098196
  • F:CACTGCTCTGCTTTCCTTCCAT
  • R:AACTGCCCACTATTCTCGTCTC
120 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ziniu Deng
  • Email: deng7009@163.com
  • Institution: Horticulture and Landscape College, Hunan Agricultural University, Furong District, Changsha 410128, Hunan, China

Citation Statistics

Cited by 80 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Yan J, Yuan F, Long G, et al. Selection of reference genes for quantitative real-time RT-PCR analysis in citrus[J]. Molecular biology reports, 2012, 39(2): 1831-1838.
  2. Pawadee Methacanon, Jaruwan Krongsin, Chaiwut Gamonpilas, Pomelo () pectin: Effects of extraction parameters and its properties, Food Hydrocolloids, Volume 35, 2014, Pages 383-391, ISSN 0268-005X.

Categories