Citrus sinensis

From ICG
Jump to: navigation, search

Description

Citrus sinensis.png
  • Citrus sinensis, also known as the Sweet Orange Group, includes the commonly cultivated sweet orange, blood oranges, and navel oranges. The orange fruit is an important agricultural product, used for both the juicy fruit pulp and the aromatic peel (rind). Orange blossoms (the flowers) are used in several different ways, as are the leaves and wood of the tree. Citrus plants contain large amounts of flavonoids with beneficial effects on human health[1][2].
  • Common Name: Orange
  • NCBI Taxonomy

Different Genotypes

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
18SrRNA[1] 18S ribosomal RNA
  • Diverse cultivars and tissues
FJ356261
  • F:TCGGGTGTTTTCACGTCTCA
  • R:TGGATGCCGCTGGGAAGC
120 58 SYBR
ACTB[1] Beta actin
  • Diverse cultivars and tissues
CB250364
  • F:CCAATTCTCTCTTGAACCTGTCCTT
  • R:GAAGACCGTCAAGAGTAGTCAGT
120 58 SYBR
rpII[1] RNA polymerase II
  • Diverse cultivars and tissues
ET098196
  • F:CACTGCTCTGCTTTCCTTCCAT
  • R:AACTGCCCACTATTCTCGTCTC
120 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ziniu Deng
  • Email: deng7009@163.com
  • Institution: Horticulture and Landscape College, Hunan Agricultural University, Furong District, Changsha 410128, Hunan, China

Citation Statistics

Cited by 80 (Based on Google Scholar [2017-09-01])

Somatic Embryogenic and Adult Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
snoR14[3] Csi-snoR14
  • Somatic embryogenic tissues
NA
  • F:TTCATGTCTGTCAATCCACTG
  • R:AACCTGTCGGGATTCAAGATA
59 NA SYBR
snoRD25[3] Csi-snoRD25
  • Somatic embryogenic tissues
NA
  • F:ACGGTGATGAGTCTACAGAC
  • R:CAGTCCCTTAGATGTTCGTAAG
72 NA SYBR
U4[3] Csi-U4
  • Adult tissues
NA
  • F:GCAATGACGCAGCTTATGAGG
  • R:CAAAGGGAGCCCTTCCAGAA
126 NA SYBR

Molecular Types

  • miRNA

Evaluation Methods

Contact

  • Name: Wen-Wu Guo
  • Email: guoww@mail.hzau.edu.cn
  • Institution: Key Laboratory of Horticultural Plant Biology (Ministry of Education), National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, China

Citation Statistics

Cited by 38 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Yan J, Yuan F, Long G, et al. Selection of reference genes for quantitative real-time RT-PCR analysis in citrus[J]. Molecular biology reports, 2012, 39(2): 1831-1838.
  2. Pepe G, Pagano F, Adesso S, Sommella E, Ostacolo C, Manfra M, Chieppa M, Sala M, Russo M, Marzocco S, Campiglia P. Bioavailable Citrus sinensis Extract: Polyphenolic Composition and Biological Activity. Molecules. 2017 Apr 15;22(4).
  3. 3.0 3.1 3.2 Kou, Shu-Jun, et al. Selection and validation of suitable reference genes for miRNA expression normalization by quantitative RT-PCR in citrus somatic embryogenic and adult tissues. Plant cell reports 31.12 (2012): 2151-2163.

Categories