Lucilia sericata

Description

Lucilia sericata is a blow fly found in most areas of the world, and the most well-known of the numerous green bottle fly species. It is the only species currently approved for maggot debridement therapy (MDT), an alternative treatment for chronic and recalcitrant wounds. Larvae of the blowfly facilitate wound healing by removing dead tissue and biofilms from non-healing and necrotic wounds. Another beneficial action of larvae and their excretions/secretions (ES) is down-regulation of excessive inflammation ^[1] ^[2].
Common Name: Common green bottle fly
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
EF1α^[1]	Elongation factor 1-alpha 1	Midgut, hindgut, salivary glands, crop and fat body Boost the larval immune system	KR133396	F:TGTCGGTGTCAACAAGATGG R:GAGATGGGAACGAAGGCAAC	137	60	SYBR
RPLP0^[1]	60S acidic ribosomal protein P0	Midgut, hindgut, salivary glands, crop and fat body Boost the larval immune system	KR133397	F:GGTGCTGATAATGTTGGTTC R:ACCCATAAGGACGACACC	78	60	SYBR
RPS3^[1]	40S ribosomal protein S3	Midgut, hindgut, salivary glands, crop and fat body Boost the larval immune system	KR133395	F:TCAAGGTGTTTTGGGTATCAAGG R:GCGGGCATTTTGTATTCTGTTTC	78	60	SYBR

Name: Zdeněk Franta
Email: zdenek.franta@ime.fraunhofer.de
Institution:Department of Bioresources, Fraunhofer Institute for Molecular Biology and Applied Ecology, Giessen,Germany

Cited by 10 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Baumann A, Lehmann R, Beckert A, Vilcinskas A, Franta Z (2015) Selection and Evaluation of Tissue Specific Reference Genes in Lucilia sericata during an Immune Challenge. PLoS One 10, e0135093.
↑ Tamura T, Cazander G, Rooijakkers SHM, Trouw LA, Nibbering PH (2017) Excretions/secretions from medicinal larvae (Lucilia sericata) inhibit complement activation by two mechanisms. Wound Repair and Regeneration 25, 41-50.