Callithrix jacchus

Description

• Callithrix jacchus is a small New World primate that is native to eastern Brazil and has been employed in recent biomedical studies in, for example, reproductive biology, infectious disease and drug development. In particular, marmosets have been used for neuroscience and behavioral studies, such as, pathological studies of Alzheimer's disease, Parkinson's disease, Huntington's disease, Multiple sclerosis and studies of anxiety and stress .
• Common Name: Common marmoset
• NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
RN18S1	18S ribosomal RNA	Thyroid,thymus, heart Lung, liver, adrenal Gland, kidney, spleen stomach Small intestine, colon and muscle	AB571241	F:CGCGGTTCTATTTTGTTGGT R:AGTCGGGCATCGTTTATGGTC	219	62	SYBR
RPLP0	Ribosomal protien,large, PO	Thyroid,thymus, heart Lung, liver, adrenal Gland, kidney, spleen stomach Small intestine, colon and muscle	XM_002753074	F:GCTCAACATCTCTCCCTTCTCCT R:GCTCAACATCTCTCCCTTCTCCT	140	60	SYBR
ACTB	b-Actin	Brain areas (cerebral cortex, striatum, hippocampus, thalamus and cerebellum)	DD279463	F:AGCAGTCGGTTGGAGCGAGCAT R:TGGCTTTTGGGAGGGCAAGGGA	139	62	SYBR
PPIA	Peptidylprolyl isomerace (Cyclophilin) A	Brain areas (cerebral cortex, striatum, hippocampus, thalamus and cerebellum)	ENSCJAT00000023248	F:TGCTGGACCCAACAGAAACGGT R:AAAGCGCTCCATGGCCTCCA	130	60	SYBR

Molecular Types

• mRNA

Evaluation Methods

• geNorm method && Related Reference
• NormFinder method && Related Reference

Contact

• Name: Hiroshi Kitamura
• Email: ktmr@med.nagoya-cu.ac.jp
• Institution: Department of Comparative and Experimental Medicine, Graduate School of Medical Sciences, Nagoya City University, Kawasumi 1, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japan

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])