Corchorus capsularis

From ICG
Jump to: navigation, search

Description

Corchorus capsularis.png
  • Corchorus capsularis L. is an annual herbaceous fiber crop. It is found predominantly in Southeast Asia and is the second cheapest and most commercially available fiber crop. It provides a biodegradable and renewable lignocellulose fiber. Jute is a promising and featured fiber material among many value-added industrial products, due in large part to its high luster, moisture absorption properties, ability for rapid water loss, and easy breakdown. Furthermore, jute has much potential for use in the industrial production of packaging materials[1] [2].
  • Common Name: White jute
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT7[1] Actin 7
  • Biotic stress and NaCl stress subsets
GH985158
  • F:ACAATTGGAGCAGAGCGTTT
  • R:TAGACCCACCGCTAAGCACT
166 60 SYBR
UBC[1] Ubiquitin-conjugating enzyme like protein
  • PEG stress subset
GR463733
  • F:CTGCCATCTCCTTTTTCAGC
  • R:CGAGTGTCCGTTTTCATTCA
150 60 SYBR
DnaJ[1] Chaperone protein dnaJ
  • PEG stress subset
GR463675
  • F:TGTATGCACCGAGGAAAATG
  • R:GTGGAAAAATCGTTGGCAAT
154 60 SYBR
TUBβ[1] Beta-tubulin
  • Different tissues
JK743820
  • F:CTGGTTCCTCTTCCTCACCA
  • R:ACAAGATGTTCAGGCGTGTG
201 60 SYBR
UBI[1] Ubiquitin extension protein
  • Different tissues
GH985256
  • F:CCACTCTCCACCTTGTCCTC
  • R:CAGCCTCTGAACCTTTCCAG
158 60 SYBR
EF1α[1] Elongation factor 1-alph
  • Different tissues
GH985217
  • F:GAAGAAGGACCCATCTGGTG
  • R:TCCACAAAACCGCAATGTAA
130 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jianmin Qi
  • Email: qijm863@163.com
  • Institution: Key Laboratory for Genetics, Breeding and Multiple Utilization of Crops, Fujian Agriculture and Forestry University, Fuzhou, China

Citation Statistics

Cited by 18 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Niu X, Qi J, Zhang G, et al. (2015) Selection of reliable reference genes for quantitative real-time PCR gene expression analysis in Jute (Corchorus capsularis) under stress treatments. Front Plant Sci 6, 848.
  2. Das NN, Das SC, Mukherjee AK (1984) ON THE ESTER LINKAGE BETWEEN LIGNIN AND 4-O-METHYL-D-GLUCURONO-D-XYLAN IN JUTE FIBER (CORCHORUS-CAPSULARIS). Carbohydrate Research 127, 345-348.

Categories