Cordyceps militaris

From ICG
Jump to: navigation, search

Description

Cordyceps militaris.png
  • Cordyceps militaris belonging to the division ascomycota, class sordariomycetes, order hypocreales, family clavicipitaceae and is entomopathogenic and endoparasitic fungi. Cordyceps species are known as Dong-Chong-Xia-Cao in China because it is parasitic in the host's body in winter and forms stroma like grass after killing host and absorbing nutrients of host in summer. Cordyceps militaris is considered a model organism for the study of Cordyceps species, which are highly prized in traditional Chinese medicine[1][2].
  • Common Name: Dong-Chong-Xia-Cao
  • NCBI Taxonomy

Different Developmental Stages & Media

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
rpb1[1] Polymerase II large subunit
  • Universial reference gene
KC242729.1
  • F:CTGTTCCCCCTCCTCCTGTG
  • R:CTGTTCCCCCTCCTCCTGTG
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Caihong Dong
  • Email: dongch@im.ac.cn
  • Institution: Laboratorio de Genética, Departamento de Acuicultura, Centro de Investigación Científica y de Educación Superior de Ensenada, Carretera Tijuana-Ensenada N° 3918, Zona Playitas C.P 22860, Ensenada BC, Mexico

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 Lian T, Yang T, Liu G, Sun J, Dong C (2014) Reliable reference gene selection for Cordyceps militaris gene expression studies under different developmental stages and media. FEMS Microbiol Lett 356, 97-104.
  2. Kang N, Lee HH, Park I, Seo YS (2017) Development of High Cordycepin-Producing Cordyceps militaris Strains. Mycobiology 45, 31-38.

Categories