Corynebacterium pseudotuberculosis

From ICG
Jump to: navigation, search

Description

Corynebacterium pseudotuberculosis.png
  • Corynebacterium pseudotuberculosis is a pleomorphic, Gram-positive and facultative intracellular rod, causing suppurative conditions in several species, as horses, goats, sheep, cattle, swine, buffaloes, llamas, camels, deer, hedgehogs, laboratory animals and occasionally in humans. C. pseudotuberculosis is classified into two biotypes according to host preferences and ability to reduce nitrate. Nitrate-negative biovar Ovis strains predominantly infect small domestic ruminants and may infect cattle, while nitrate-positive biovar Equi strains usually infect horses, cattle and water buffalo [1] [2].
  • Common Name: NA
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
gyrA[1] DNA gyrase subunit A
  • Universial reference gene
NA
  • F:CCGCTCTATCTTTGTCCCTTATC
  • R:TCGTTGACGTTGTCCCATAC
103 60 SYBR
fusA[1] Elongation factor P
  • Universial reference gene
NA
  • F:GAGTACATGGGCGACGTTATC
  • R:GAACCTTTGCTTGACTACCT
100 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Luis G.C.Pacheco
  • Email: luis.pacheco@ufba.br
  • Institution: Institute of Health Sciences, Federal University of Bahia, Salvador, BA, Brazil

Citation Statistics

Cited by 8 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Carvalho DM, de Sa PH, Castro TL, et al. (2014) Reference genes for RT-qPCR studies in Corynebacterium pseudotuberculosis identified through analysis of RNA-seq data. Antonie Van Leeuwenhoek 106, 605-614.
  2. Haas DJ, Dorneles EMS, Spier SJ, et al. (2017) Molecular epidemiology of Corynebacterium pseudotuberculosis isolated from horses in California. Infection Genetics and Evolution 49, 186-194.

Categories