Macaca fascicularis

Description

Macaca fascicularis is one of the most commonly used nonhuman primate animal models for studying various diseases, such as inflammation, atherogenesis, chronic wasting disease (CWD), amyotrophic lateral sclerosis (ALS), Parkinson’s disease, Alzheimer’s disease, and chikungunya disease because of its biological and behavioral similarities to, and close genetic relationship with, humans^[1]^[2].
Common Name: Crab-eating macaque
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
ARFGAP2^[1]	ADP-ribosylation factor GTPase activating protein 2	Cecum, cerebrum, heart, kidney, liver, lung, pancreas, salivary gland, skeletal muscle, small intestine, spleen, stomach, and uterus	NA	F:GCGTCCATCTGAGCTTCATC R:CATCATTGGCTGTGCATCCA	135	60	SYBR
MRFAP1^[1]	Morf4 family associated protein 1	Cecum, cerebrum, heart, kidney, liver, lung, pancreas, salivary gland, skeletal muscle, small intestine, spleen, stomach, and uterus	NA	F:GCGGATAGAGAAGAGCGAGT R:AGCCAATCTCCACCAGTTGA	82	60	SYBR
ARL1^[1]	ADP-ribosylation factor-like 1	Cecum, cerebrum, heart, kidney, liver, lung, pancreas, salivary gland, skeletal muscle, small intestine, spleen, stomach, and uterus	NA	F:AGACAGTTGTGACCGAGACC R:TGAGGAAGTCATGGCCTGTT	136	60	SYBR

Name: Heui-Soo Kim
Email: khs307@pusan.ac.kr
Institution: National Primate Research Center, Korea Research Institute of Bioscience and Biotechnology, Chungbuk, Republic of Korea

Cited by 15 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Park S J, Kim Y H, Huh J W, et al. Selection of new appropriate reference genes for RT-qPCR analysis via transcriptome sequencing of cynomolgus monkeys (Macaca fascicularis)[J]. PLoS One, 2013, 8(4): e60758.
↑ De Pablos V, Barcia C, Martinez S, Gomez A, Ros-Bernal F, et al. (2009) MPTP administration increases plasma levels of acute phase proteins in non-human primates (Macaca fascicularis). Neurosci Lett 463: 37–39.