Craterostigma plantagineum

From ICG
Jump to: navigation, search

Description

Craterostigma plantagineum-1.jpg
  • Craterostigma plantagineum is one of the few higher plants capable of surviving desiccation throughout its vegetative tissues. Craterostigma plantagineum is a homoichlorophyllous resurrection plant in which thylakoid membranes stay intact during desiccation. As a desiccation tolerant resurrection plant, it has been used to study the expression of genes involved in tolerance to water deficit [1][2][3].
  • Common Name: Blue gem
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
TKT3[1] Transketolase 3
  • Leaves
NA
  • F:AGGTGAAAAAGGAGTGAAAATGG
  • R:GTCTGCTGCAAACATGAGAAAA
101 60 SYBR
EIF5A[1] Eukaryotic initiation factor 5A
  • Leaves
  • Roots
NA
  • F:CATCAATCGTGAAGGAGAGGA
  • R:CTAAACCTTGGCAGCAGCAC
149 60 SYBR
YLS8[1] Yellow-Leaf-Specific gene 8
  • Leaves
  • Callus tissue
NA
  • F:TCATCCGTCTCCTCAGGTGT
  • R:TCAACAGCACAAAAGCATCAA
125 60 SYBR
EF1α[1] Elongation factor 1-alpha
  • Roots
NA
  • F:TCGTATCTGCTTTTGCATTGAGT
  • R:ACGAACAGCAACGACTCACA
70 60 SYBR
GAPDH[1] Glyceraldehyde-3 phosphate dehydrogenase
  • Roots
  • Callus tissue
NA
  • F:GGCTTCGATTCGGATCTTCT
  • R:AGCCCACAAATATATCAAGAACTCA
94 60 SYBR
CAC[1] Clathrin adaptor complexes medium subunit
  • Callus tissue
NA
  • F:TTGAGGAAGTTTGCGACGAG
  • R:TGGCCTTGTAATAGAATGGTACG
107 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Dorothea Bartels
  • Email: dbartels@uni-bonn.de
  • Institution: Institute of Molecular Physiology and Biotechnology of Plants University of Bonn, Kirschallee 1, D-53115 Bonn, Germany

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Giarola V, Challabathula D, Bartels D. Quantification of expression of dehydrin isoforms in the desiccation tolerant plant Craterostigma plantagineum using specifically designed reference genes. Plant Sci. 2015 Jul;236:103-15. doi: 10.1016/j.plantsci.2015.03.014. Epub 2015 Mar 28. PubMed PMID: 26025524.
  2. Jones L, McQueen-Mason S. A role for expansins in dehydration and rehydration of the resurrection plant Craterostigma plantagineum[J]. FEBS letters, 2004, 559(1-3): 61-65.
  3. Gasulla F, Dorp K, Dombrink I, et al. The role of lipid metabolism in the acquisition of desiccation tolerance in Craterostigma plantagineum: a comparative approach[J]. The Plant Journal, 2013, 75(5): 726-741.

Categories