Cucumis melo

From ICG
Jump to: navigation, search

Description

Cucumis melo.png
  • Cucumis melo L. a member of the Cucurbitaceae family, ranks as the 9th most cultivated horticultural crop in terms of total world production. In addition to its significant economic value, melon is also an attractive model for the study of valuable biological characteristics, such as fruit ripening, sex determination, and phloem physiology. The full sequence of melon genome is readily available, which greatly facilitates the identification of genes underlying certain traits and the elucidation of mechanisms that regulate relevant characteristics.
  • Common Name: Melon
  • NCBI Taxonomy

Abiotic Stress Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
CmADP[1] ADP ribosylation factor 1
  • Roots and leaves
  • Fusarium wilt and bacterial fruit blotch
  • Low temperature, salinity, and drought
MU47713
  • F:ATATTGCCAACAAGGCGTAGA
  • R:TGCCCGTAAACAAGGGATAAA
93 60 SYBR
CmUBIep[1] Ubiquitin extension protein
  • Roots and leaves
  • Fusarium wilt and bacterial fruit blotch
  • Low temperature, salinity, and drought
MU54467
  • F:AAGTGTGGACACAGCAACCA
  • R:AAGCCAAATGGCTCTAAGCA
132 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Zhilong Bie
  • Email: biezhilong@hotmail.com
  • Institution: Key Laboratory of Horticultural Plant Biology, Ministry of Education/College of Horticulture and Forestry, Huazhong Agricultural University, Wuhan, P. R. China

Citation Statistics

Cited by 24 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 Kong Q, Yuan J, Niu P, et al. Screening suitable reference genes for normalization in reverse transcription quantitative real-time PCR analysis in melon[J]. PLoS One, 2014, 9(1): e87197.

Categories