Cymbidium kanran

From ICG
Jump to: navigation, search

Description

Cymbidium kanran.png
  • Cymbidium kanran is an important commercial member of the Chinese orchid family due to its delicate fragrance, attractive color, shape, and the scent of its flowers. It possesses a high economic value as an ornamental plant. As the focus in evaluation of orchid, the labellum exhibits various morphological variations. It is exclusively distributed in a few neighboring countries in Northeast Asia (China, Japan, Korea, and Taiwan), and now among the endangered species facing extinction. Jeju Island is the only place in Korea where a small number of wild populations still exist[1][2].
  • Common Name: Cold-growing cymbidium
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ACT[1] Actin
  • ABA,NaCl,cold,CuSO4,PbAC treatment
NA
  • F:CTAGCATAAAGAGAGAGCACGGC
  • R:GCAAATAGAGAGAAGATGACCCA
95 60 SYBR
RPS3[1] RPS3
  • NAA, 6-BA and GA treatments
NA
  • F:TGAAGCCAATGCAGAACAAACG
  • R:ATGGATTTCACCACCGACAAGC
121 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Boyun Yang
  • Email: 572460991@163.com
  • Institution: Jiangxi Key Laboratory of Plant Resources, School of Life Science and Food Engineering, Nanchang University, Nanchang 330031, Jiangxi, People’s Republic of China

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Luo H, Luo K, Luo L, et al. (2014) Evaluation of candidate reference genes for gene expression studies in Cymbidium kanran. Scientia Horticulturae 167, 43-48.
  2. Hong JW, Suh H, Kim OH, Lee NS (2015) Molecular Identification of Mycorrhizae of Cymbidium kanran (Orchidaceae) on Jeju Island, Korea. Mycobiology 43, 475-480.

Categories